ID: 1047192370

View in Genome Browser
Species Human (GRCh38)
Location 8:122689792-122689814
Sequence GACTAACACCCCAGGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047192370_1047192374 21 Left 1047192370 8:122689792-122689814 CCATAAATCCTGGGGTGTTAGTC No data
Right 1047192374 8:122689836-122689858 TTTCCACTCCCCAACACTCAGGG No data
1047192370_1047192375 22 Left 1047192370 8:122689792-122689814 CCATAAATCCTGGGGTGTTAGTC No data
Right 1047192375 8:122689837-122689859 TTCCACTCCCCAACACTCAGGGG No data
1047192370_1047192373 20 Left 1047192370 8:122689792-122689814 CCATAAATCCTGGGGTGTTAGTC No data
Right 1047192373 8:122689835-122689857 TTTTCCACTCCCCAACACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047192370 Original CRISPR GACTAACACCCCAGGATTTA TGG (reversed) Intergenic
No off target data available for this crispr