ID: 1047195243

View in Genome Browser
Species Human (GRCh38)
Location 8:122715137-122715159
Sequence CCTTACATGGGAACATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047195232_1047195243 14 Left 1047195232 8:122715100-122715122 CCTGCATAATGTCCTACAGCCAC No data
Right 1047195243 8:122715137-122715159 CCTTACATGGGAACATTGGAGGG No data
1047195234_1047195243 2 Left 1047195234 8:122715112-122715134 CCTACAGCCACCATTGGTCTCTC No data
Right 1047195243 8:122715137-122715159 CCTTACATGGGAACATTGGAGGG No data
1047195236_1047195243 -8 Left 1047195236 8:122715122-122715144 CCATTGGTCTCTCTCCCTTACAT No data
Right 1047195243 8:122715137-122715159 CCTTACATGGGAACATTGGAGGG No data
1047195235_1047195243 -5 Left 1047195235 8:122715119-122715141 CCACCATTGGTCTCTCTCCCTTA No data
Right 1047195243 8:122715137-122715159 CCTTACATGGGAACATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047195243 Original CRISPR CCTTACATGGGAACATTGGA GGG Intergenic
No off target data available for this crispr