ID: 1047195829

View in Genome Browser
Species Human (GRCh38)
Location 8:122720695-122720717
Sequence TTGCTGTTGTTGTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6733
Summary {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047195829 Original CRISPR TTGCTGTTGTTGTTGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr