ID: 1047200404

View in Genome Browser
Species Human (GRCh38)
Location 8:122760456-122760478
Sequence GGCTGGGCTTGAAACCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047200400_1047200404 -3 Left 1047200400 8:122760436-122760458 CCCAGTGAACATTTCTTTCAGGC No data
Right 1047200404 8:122760456-122760478 GGCTGGGCTTGAAACCTCAGAGG No data
1047200398_1047200404 -2 Left 1047200398 8:122760435-122760457 CCCCAGTGAACATTTCTTTCAGG No data
Right 1047200404 8:122760456-122760478 GGCTGGGCTTGAAACCTCAGAGG No data
1047200401_1047200404 -4 Left 1047200401 8:122760437-122760459 CCAGTGAACATTTCTTTCAGGCT No data
Right 1047200404 8:122760456-122760478 GGCTGGGCTTGAAACCTCAGAGG No data
1047200397_1047200404 12 Left 1047200397 8:122760421-122760443 CCTGAACTGATAAGCCCCAGTGA No data
Right 1047200404 8:122760456-122760478 GGCTGGGCTTGAAACCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047200404 Original CRISPR GGCTGGGCTTGAAACCTCAG AGG Intergenic
No off target data available for this crispr