ID: 1047201881

View in Genome Browser
Species Human (GRCh38)
Location 8:122774052-122774074
Sequence CCTCCTGGAAACCAGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047201870_1047201881 21 Left 1047201870 8:122774008-122774030 CCAGAGTCAGAGAGAAGCAGAAA No data
Right 1047201881 8:122774052-122774074 CCTCCTGGAAACCAGGAGTGGGG No data
1047201872_1047201881 -5 Left 1047201872 8:122774034-122774056 CCTCTGGAGAAAACCCCTCCTCC No data
Right 1047201881 8:122774052-122774074 CCTCCTGGAAACCAGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047201881 Original CRISPR CCTCCTGGAAACCAGGAGTG GGG Intergenic
No off target data available for this crispr