ID: 1047202412

View in Genome Browser
Species Human (GRCh38)
Location 8:122778562-122778584
Sequence GGTCCCCTGTTGTTGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202412_1047202418 1 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202418 8:122778586-122778608 ATTAAGTCCAAAGGTGGTTGAGG No data
1047202412_1047202416 -5 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202416 8:122778580-122778602 GGACCAATTAAGTCCAAAGGTGG No data
1047202412_1047202415 -8 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202415 8:122778577-122778599 AGGGGACCAATTAAGTCCAAAGG No data
1047202412_1047202420 28 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202420 8:122778613-122778635 TGTTTTAAAAGTCTATTCTCTGG No data
1047202412_1047202421 29 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202412 Original CRISPR GGTCCCCTGTTGTTGGGCAT TGG (reversed) Intergenic