ID: 1047202413

View in Genome Browser
Species Human (GRCh38)
Location 8:122778568-122778590
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202413_1047202422 30 Left 1047202413 8:122778568-122778590 CCCAACAACAGGGGACCAATTAA No data
Right 1047202422 8:122778621-122778643 AAGTCTATTCTCTGGGAAGCAGG No data
1047202413_1047202420 22 Left 1047202413 8:122778568-122778590 CCCAACAACAGGGGACCAATTAA No data
Right 1047202420 8:122778613-122778635 TGTTTTAAAAGTCTATTCTCTGG No data
1047202413_1047202421 23 Left 1047202413 8:122778568-122778590 CCCAACAACAGGGGACCAATTAA No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202413_1047202418 -5 Left 1047202413 8:122778568-122778590 CCCAACAACAGGGGACCAATTAA No data
Right 1047202418 8:122778586-122778608 ATTAAGTCCAAAGGTGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202413 Original CRISPR TTAATTGGTCCCCTGTTGTT GGG (reversed) Intergenic