ID: 1047202415

View in Genome Browser
Species Human (GRCh38)
Location 8:122778577-122778599
Sequence AGGGGACCAATTAAGTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202412_1047202415 -8 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202415 8:122778577-122778599 AGGGGACCAATTAAGTCCAAAGG No data
1047202411_1047202415 -7 Left 1047202411 8:122778561-122778583 CCCAATGCCCAACAACAGGGGAC No data
Right 1047202415 8:122778577-122778599 AGGGGACCAATTAAGTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202415 Original CRISPR AGGGGACCAATTAAGTCCAA AGG Intergenic