ID: 1047202419

View in Genome Browser
Species Human (GRCh38)
Location 8:122778593-122778615
Sequence ACACTGTCCTCAACCACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202419_1047202421 -2 Left 1047202419 8:122778593-122778615 CCAAAGGTGGTTGAGGACAGTGT No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202419_1047202422 5 Left 1047202419 8:122778593-122778615 CCAAAGGTGGTTGAGGACAGTGT No data
Right 1047202422 8:122778621-122778643 AAGTCTATTCTCTGGGAAGCAGG No data
1047202419_1047202420 -3 Left 1047202419 8:122778593-122778615 CCAAAGGTGGTTGAGGACAGTGT No data
Right 1047202420 8:122778613-122778635 TGTTTTAAAAGTCTATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202419 Original CRISPR ACACTGTCCTCAACCACCTT TGG (reversed) Intergenic