ID: 1047202421

View in Genome Browser
Species Human (GRCh38)
Location 8:122778614-122778636
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202414_1047202421 22 Left 1047202414 8:122778569-122778591 CCAACAACAGGGGACCAATTAAG No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202413_1047202421 23 Left 1047202413 8:122778568-122778590 CCCAACAACAGGGGACCAATTAA No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202419_1047202421 -2 Left 1047202419 8:122778593-122778615 CCAAAGGTGGTTGAGGACAGTGT No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202412_1047202421 29 Left 1047202412 8:122778562-122778584 CCAATGCCCAACAACAGGGGACC No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202417_1047202421 8 Left 1047202417 8:122778583-122778605 CCAATTAAGTCCAAAGGTGGTTG No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data
1047202411_1047202421 30 Left 1047202411 8:122778561-122778583 CCCAATGCCCAACAACAGGGGAC No data
Right 1047202421 8:122778614-122778636 GTTTTAAAAGTCTATTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202421 Original CRISPR GTTTTAAAAGTCTATTCTCT GGG Intergenic