ID: 1047202881

View in Genome Browser
Species Human (GRCh38)
Location 8:122781484-122781506
Sequence GAGGCTAGCCCTAAAGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202881_1047202893 23 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202881_1047202892 14 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202881_1047202894 26 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202881_1047202897 29 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202881_1047202895 27 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202881_1047202896 28 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202881 Original CRISPR GAGGCTAGCCCTAAAGGCGC TGG (reversed) Exonic
901072782 1:6530892-6530914 GAGGCTAGGACTGAAGCCGCAGG - Intronic
903121273 1:21218339-21218361 GAGGTTAGCCCTGCAGGCACCGG + Intronic
905276182 1:36819629-36819651 GAGGCTACCCCTAGAGGTGTGGG + Intronic
909129332 1:71714983-71715005 GAGGTTCTCCCTAAAGGCTCTGG + Intronic
914812494 1:151039064-151039086 GAGGCTAGAGCTAAAGGATCAGG + Intronic
915554901 1:156656010-156656032 GAGCCCAGCCCAAAAGGGGCTGG - Intronic
916988934 1:170221127-170221149 GAGCCTTGCCCAAAAGGAGCAGG - Intergenic
1076714435 10:132356143-132356165 GAGGCAAGCCCTCAAGGCTGGGG - Intronic
1085177943 11:74507147-74507169 GAGCCTGGCACTAAAGGCTCAGG - Intronic
1091262098 11:134242763-134242785 GAGGCTAGTCCCACAAGCGCAGG - Intronic
1097269879 12:57767416-57767438 GAGGATGGGCCTAAAGGGGCTGG - Intronic
1103961125 12:124609894-124609916 GAGGCTAGCCTCAGAGGCTCTGG + Intergenic
1108422613 13:50266304-50266326 GAGGCTAGCCCTAGTGGAACCGG + Intronic
1115308182 14:31953149-31953171 GAGGCTGGCCCTCATGGCTCAGG + Intergenic
1115917633 14:38334410-38334432 GAGGTTAGCCCAAAAGGATCAGG + Intergenic
1119985540 14:79133016-79133038 GAGGCCAACCCTGAAGGCGCTGG + Intronic
1121285817 14:92735043-92735065 GAGTCTAGCCCTCAAAGCGATGG + Intronic
1127930629 15:63594917-63594939 GAGTCTAGCTCTAAAGGGGAAGG - Intergenic
1131279273 15:91007632-91007654 GTGGCTAGCCCTAGAAGCCCTGG + Intronic
1142761273 17:2043134-2043156 GAGGCTGCCCCTAGAGGAGCTGG - Exonic
1151713586 17:75820151-75820173 GAGGCACCTCCTAAAGGCGCAGG - Intronic
1155853213 18:30798429-30798451 GAGGCTATCTCTAAAGACTCTGG - Intergenic
1160221569 18:76981728-76981750 GAGGCTGGCCCTCGAGGGGCAGG - Intronic
1160745573 19:709459-709481 GAGGCTCGCCCTGGAGACGCGGG - Intronic
1164436022 19:28230191-28230213 GAGGCCAGCCCAAAGGGCGCTGG - Intergenic
1166000773 19:39876221-39876243 GTGGCTGGGACTAAAGGCGCAGG - Intronic
927199198 2:20568000-20568022 GAGACCAGCCCTAGAGGAGCAGG - Intronic
1170963811 20:21049026-21049048 GAGGCTGGCACAAAAGGCACTGG + Intergenic
1180698635 22:17769918-17769940 GAGGCTAGGCCTGAGGGCACCGG - Intronic
952849191 3:37713771-37713793 CTGGCCAGCCCTAAAGGCCCGGG + Intronic
959009219 3:101055490-101055512 GAAGCTAGACCTAAAGGATCTGG - Intergenic
968508500 4:983629-983651 GAGCAAAGACCTAAAGGCGCAGG - Intronic
968984434 4:3867423-3867445 GAGGCTGGCTCTGAAGGCCCTGG - Intergenic
970540827 4:17077211-17077233 GAGGCTATCCCCAAAGGAGCCGG - Intergenic
975695484 4:77008647-77008669 GAGGCTAACCCTAAAACCGATGG - Intronic
977171447 4:93767624-93767646 GAGACCAGCCCTTAAGGCTCTGG - Intronic
997613361 5:135230382-135230404 GAGGCTGAGCCTCAAGGCGCTGG - Intronic
999913623 5:156233447-156233469 GAGGCAAGCACTAAAAGCTCGGG + Intronic
1002177455 5:177409324-177409346 GAGGCCAGCCCGGAAGGCCCAGG - Intronic
1016650346 6:146454289-146454311 GTGGCTAGAGCTAAAGGCACAGG - Intergenic
1027386535 7:77664507-77664529 GTGGCTGGGACTAAAGGCGCGGG - Intergenic
1032727313 7:134602772-134602794 GGAGCTAGCCCTAAAGGCACTGG + Intergenic
1036662153 8:10715522-10715544 GAGACTGGCCCTAGAGGGGCAGG + Intergenic
1045599266 8:103694318-103694340 GAGGCTAGGGCTACAGGGGCTGG + Intronic
1047202881 8:122781484-122781506 GAGGCTAGCCCTAAAGGCGCTGG - Exonic
1047415894 8:124664131-124664153 GGGGGTAGCCCTGCAGGCGCTGG - Intronic
1050063828 9:1737942-1737964 GAGGCAATCCCTGAAGGGGCAGG + Intergenic
1059655756 9:116355799-116355821 GAGGCTAGTCGCAAAGGAGCAGG + Intronic
1189002574 X:36962438-36962460 AAGTCTAGTCCCAAAGGCGCTGG - Intergenic