ID: 1047202882

View in Genome Browser
Species Human (GRCh38)
Location 8:122781490-122781512
Sequence GGGGGGGAGGCTAGCCCTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202882_1047202896 22 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202882_1047202895 21 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202882_1047202893 17 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202882_1047202894 20 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202882_1047202897 23 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202882_1047202892 8 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202882 Original CRISPR GGGGGGGAGGCTAGCCCTAA AGG (reversed) Exonic
900427345 1:2586705-2586727 GGGGCGGAGACGAGCCCGAAGGG + Intronic
907430629 1:54409218-54409240 GGAGGGGATGTTAGCCTTAAAGG - Intronic
912953533 1:114136710-114136732 ATGGGGGAGGCCAGCCCAAAAGG - Intronic
915286431 1:154856245-154856267 GGGAGGGAGGCTGGCCAGAAGGG + Intronic
916644591 1:166770482-166770504 GGGAGGGAGGCTAGCTCTAAGGG - Intergenic
917944476 1:179954915-179954937 CGGGGGGTGGCTTGCCCTGAGGG + Exonic
1072741755 10:97914108-97914130 GGGGAGGAGGCGAGGCCTAGGGG + Intronic
1072764961 10:98087809-98087831 GGGGTGCAGGGTAGCCCTATAGG - Intergenic
1075859596 10:125662865-125662887 GGGGGTGTGGCTAGCTCTTATGG + Intronic
1077139199 11:1016159-1016181 GTGGGGGAGAGTGGCCCTAATGG + Exonic
1079327233 11:19504754-19504776 GGGGGAGGGGCTATCTCTAAAGG - Intronic
1084096560 11:66915304-66915326 GGGAGGGAGGCTTCCCCTGATGG + Intronic
1084644341 11:70445928-70445950 GGGAGGTACACTAGCCCTAAAGG + Intergenic
1096195515 12:49646800-49646822 GGGTGGGAGGAGAGCCCAAAGGG + Intronic
1098690409 12:73480888-73480910 AGGAGGGAGGCTAGCCATTAAGG - Intergenic
1102469723 12:113152904-113152926 GGGGGGGAGGCGGGGCCTATGGG + Intronic
1103848819 12:123917952-123917974 TGTGGGGAGGGGAGCCCTAAAGG + Intronic
1108634816 13:52322890-52322912 GGGGTGGCTGCTTGCCCTAATGG - Intergenic
1108652988 13:52500298-52500320 GGGGTGGCTGCTTGCCCTAATGG + Intergenic
1114467499 14:22933844-22933866 GGGAGGGAGGCAAGCGCTGAGGG - Intergenic
1123010688 14:105348228-105348250 GGGAGGGAGGCTCACCCTCAGGG + Intronic
1124606362 15:31172765-31172787 AGGGTGGAGGCAAGCCCTAGCGG - Intergenic
1128389659 15:67174445-67174467 AGAGGGGAGGCAAGCCCTGAAGG + Intronic
1128696219 15:69764946-69764968 GGGGAGGGGGCTGGCTCTAAAGG - Intergenic
1139430787 16:66910156-66910178 GGGGGTGGGGCTAGGCCTAGGGG - Intronic
1147371647 17:39996955-39996977 GGAGGGGAGGCTTGACCTAAGGG - Intronic
1149457241 17:56797784-56797806 GAGGAGAAGGCCAGCCCTAAAGG - Intronic
1155007386 18:21741176-21741198 CCGGGGGAGGCTAGCCCGAGGGG - Intronic
1155176808 18:23308016-23308038 GGGAGGGAGGCAGACCCTAATGG + Intronic
1161151342 19:2711626-2711648 GGGGGAGAGGCCAGCTCCAAGGG - Intergenic
1162381626 19:10334987-10335009 GGGGCGGAGACTAGCCGAAAAGG - Intronic
1164274214 19:23702633-23702655 GGGGGGGGGGCTTGCATTAAAGG - Intergenic
1164645583 19:29856686-29856708 AGGGAAGAGGCTAGCCCAAATGG - Intergenic
1164671938 19:30077379-30077401 GGTGGGCAGGCTGGCCCTCAGGG - Intergenic
1166694697 19:44846082-44846104 GGGGGCGTGGCTAGACCTTAGGG + Intergenic
1167575268 19:50314838-50314860 AGGGGGGAGGGGAGCGCTAAAGG + Intronic
1167685079 19:50950952-50950974 GGGGTGGAGCCTGGCCCAAAGGG + Intronic
925134656 2:1517925-1517947 GGGGGGGAGCCTGGCACTCAGGG - Intronic
927501498 2:23586316-23586338 GGGGGGGAGGCTGCTCTTAATGG - Intronic
927518965 2:23687965-23687987 GGGGGGCAGCCAAGCCCAAAGGG - Intronic
927795762 2:26047324-26047346 GGGGGGGAGCCAATCCCAAAAGG - Intronic
932406471 2:71515959-71515981 GGGTGGGTGGCTGGCCCTATAGG - Intronic
936921910 2:117697407-117697429 TGGGGGGAGTCCAGCCCTATGGG - Intergenic
946410597 2:219513439-219513461 GTGGGGCAGGAGAGCCCTAAGGG - Intergenic
1173825083 20:46043110-46043132 CAGGGGGAGGCCAGCCATAAGGG - Intronic
1175237744 20:57525675-57525697 GGCGGGGAGGATAGCCCTGCAGG + Intergenic
1181636869 22:24178564-24178586 AGGGGTGAGCCTGGCCCTAAAGG - Exonic
1184800129 22:46753971-46753993 CGTGGGGAGGCTGGCACTAAAGG - Intergenic
1185394202 22:50578445-50578467 GCGGGGGTGGCTAGGCCTGAAGG - Exonic
954131679 3:48564243-48564265 GGGGGGAAGGCTAGACCCACGGG + Exonic
955656630 3:61251273-61251295 GGCGGGGAGGCAAGCCCAAGTGG - Intronic
955794396 3:62620779-62620801 GTGGTGGAGGCCAGCTCTAATGG - Intronic
961147892 3:124610636-124610658 GGGGGGGCGGCTATCCCTCCAGG + Intronic
964186783 3:153955034-153955056 GAGGGGGAGGGTAGACTTAAAGG + Intergenic
968628173 4:1637401-1637423 GGGGGTGAGGCCAGCCCTCGAGG + Intronic
969088352 4:4673237-4673259 GGAGGAGAGGCTAGTCCTATAGG - Intergenic
969204722 4:5634886-5634908 GGGGTGGAGGCTGCCCCTACAGG - Intronic
991073276 5:62510612-62510634 GGGTGGGAGGCTAGCTATATGGG - Intronic
1007335701 6:41153709-41153731 GGTGGGGAGGGTAGGTCTAAGGG + Intronic
1009194147 6:60664597-60664619 TGGGAGGTGGCTAGCCCTCAGGG + Intergenic
1019122934 6:169819233-169819255 GTGGGGCAGGTTTGCCCTAAGGG - Intergenic
1019656901 7:2200798-2200820 GGAGGGGAGGCTGGGCCGAAGGG - Intronic
1023569522 7:41557503-41557525 GAGGGGGAGGCTTGCACCAAGGG + Intergenic
1027367401 7:77472762-77472784 AGGGGGAAGGAGAGCCCTAAGGG + Intergenic
1031305436 7:120120277-120120299 AGGTGGGAAGCTAGCCATAAGGG + Intergenic
1035412175 7:158653911-158653933 GAGGGGGAGGCTGGCCGTTAGGG + Intronic
1037739701 8:21598493-21598515 GGGTGGGGGGCAAGCCCCAAGGG + Intergenic
1042337813 8:67646890-67646912 GGGAGGGAGGCAGGCCCTATAGG + Intronic
1047202882 8:122781490-122781512 GGGGGGGAGGCTAGCCCTAAAGG - Exonic
1047251227 8:123183115-123183137 GGGGCGGAAGCAGGCCCTAAGGG + Exonic
1055590988 9:77813662-77813684 GAGGAGGAGGCAAACCCTAAGGG + Intronic
1056316665 9:85396992-85397014 AGGGGCGAGGGCAGCCCTAAAGG - Intergenic
1056942701 9:90968989-90969011 GTGGGTGAGGCTGGCCCTAGAGG - Intergenic
1057350434 9:94292790-94292812 GGAGGGGATCCTAGACCTAAAGG - Intronic
1057573686 9:96222559-96222581 TGTAGGGAGGCTAGCCCCAAAGG - Intergenic
1057604499 9:96489403-96489425 GGGGCGGGGGCGGGCCCTAAGGG - Intronic
1195323968 X:103743205-103743227 GGGTGGGAGGCTACCCCAAAGGG - Intergenic
1195331623 X:103807717-103807739 GGGTGGGAGGCTCCCCCAAAGGG + Intergenic
1195830646 X:109054547-109054569 GGCGGGGGGGCGAGCCCTGAGGG + Intergenic
1197804572 X:130386510-130386532 GGGGGGGAGGTTAGACCAAAGGG + Intergenic
1199717046 X:150514415-150514437 GTGGGGGAGACTTGCCCTGAGGG + Intergenic