ID: 1047202882

View in Genome Browser
Species Human (GRCh38)
Location 8:122781490-122781512
Sequence GGGGGGGAGGCTAGCCCTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202882_1047202893 17 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202882_1047202892 8 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202882_1047202896 22 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202882_1047202897 23 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202882_1047202894 20 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202882_1047202895 21 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202882 Original CRISPR GGGGGGGAGGCTAGCCCTAA AGG (reversed) Exonic