ID: 1047202883

View in Genome Browser
Species Human (GRCh38)
Location 8:122781503-122781525
Sequence TCAGGCAGGAGCTGGGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1162
Summary {0: 1, 1: 0, 2: 10, 3: 106, 4: 1045}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202883_1047202893 4 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202883_1047202894 7 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202883_1047202896 9 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202883_1047202892 -5 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202883_1047202897 10 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202883_1047202895 8 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202883 Original CRISPR TCAGGCAGGAGCTGGGGGGG AGG (reversed) Exonic
900102377 1:967377-967399 TCCCACAGGGGCTGGGGGGGGGG - Intronic
900103537 1:972798-972820 CCAGGCAGGGGCGGGTGGGGAGG + Intronic
900110858 1:1005012-1005034 AGAGGCGGGAGCTGGGAGGGGGG - Intergenic
900139471 1:1133504-1133526 TCAGGCAGAGGCTGGGCCGGCGG + Intergenic
900311370 1:2035040-2035062 TTAAGCAGCAGCTGTGGGGGCGG - Intergenic
900372413 1:2337822-2337844 GGAGGCAGGGGCTGGGGCGGTGG + Intronic
900388199 1:2420155-2420177 TGAGGTAGGGGCTGGGGCGGGGG - Intergenic
900598000 1:3491116-3491138 GGGGGCGGGAGCTGGGGGGGGGG + Intronic
900624142 1:3600491-3600513 ACAGGCGGGAGCTGGAGGGCGGG + Intronic
900709100 1:4101233-4101255 CCAGGCAGCAGCAGGGGAGGGGG - Intergenic
900803993 1:4755534-4755556 GCAGGCAGGGGGTGGGGGTGGGG - Intronic
901024928 1:6274109-6274131 TCAGGCAGGTCCTGGGGGTGGGG + Intronic
901134580 1:6984669-6984691 TCAGGCAGGACCTGGGCCAGTGG + Intronic
901226092 1:7613761-7613783 GCAGGCGGGACCTGGAGGGGTGG + Intronic
901660939 1:10797238-10797260 ACATGGAGGGGCTGGGGGGGGGG + Intergenic
901845556 1:11980136-11980158 GTCGGCCGGAGCTGGGGGGGCGG - Intergenic
902435802 1:16397580-16397602 TCAGGGAGGAGCTGGGGGAAGGG - Exonic
902495431 1:16869002-16869024 TCAAGGAGGAGCTTGGGTGGTGG - Intronic
902510840 1:16966170-16966192 TGAGGCAGGAGCCGGGGGATTGG + Intronic
902754946 1:18542737-18542759 TGAGGCTGGGGCTGGGGGTGGGG + Intergenic
902881055 1:19371986-19372008 GCAGCCAGGAGCTGGGTGGATGG - Intronic
902892151 1:19452241-19452263 GCAGGCTTGAGCTGAGGGGGTGG - Intronic
903012591 1:20342293-20342315 CCAGGAAAGAGCTGGTGGGGTGG + Intronic
903692761 1:25185893-25185915 TCAGGCCGGAGGTGGGTGGGTGG - Intergenic
903789968 1:25886099-25886121 TCAGGCAGGAACGGGGTGTGGGG + Intronic
903923184 1:26815743-26815765 TGAGGCAGGAGCCTGGGAGGCGG + Intergenic
904074357 1:27829136-27829158 CCAGGAGGGAGGTGGGGGGGGGG + Intergenic
904495814 1:30886023-30886045 TCAGGCACGAGCTTGGGGACAGG - Intronic
904610975 1:31726156-31726178 TCAGGCAGCAGCTGGAGCAGAGG - Intergenic
905029089 1:34869426-34869448 TCAGGGAGGAGCCAGGGTGGTGG + Intronic
905238723 1:36568238-36568260 TCAGGGAGAGGCTGGGGTGGGGG + Intergenic
905269334 1:36776813-36776835 GCAGGCAGGGGTTTGGGGGGCGG + Intergenic
905295694 1:36953187-36953209 TGAGGCAGGGGCAGGGGGAGGGG - Intronic
905307641 1:37030549-37030571 TAAAGCAGGTGTTGGGGGGGGGG - Intronic
905352534 1:37357459-37357481 TCAGGCAAGGGCTGGGGGAATGG - Intergenic
905676432 1:39828795-39828817 GCAGGCAGGAGATGGGGAGCTGG - Intergenic
906069189 1:43005329-43005351 TGAGGAGGGAGCTGAGGGGGAGG + Intergenic
906102090 1:43270351-43270373 TGACGCAGGAGCTGGGGCAGGGG + Intronic
906273659 1:44500729-44500751 TCTGGCAGGCTCTGGGGAGGGGG - Intronic
906531535 1:46526672-46526694 CCAGGGAGGAGCTGGGGCGGAGG - Intergenic
906557196 1:46723161-46723183 TCAGGGAGGAGGAGGTGGGGAGG + Intergenic
906580122 1:46929290-46929312 GCAGGCAGGAGTTTGGGAGGTGG + Exonic
906603606 1:47149603-47149625 GCAGGCAGGAGTTTGGGAGGTGG - Exonic
906748103 1:48235622-48235644 AGAGTCAGGAGCTGGGGGTGGGG - Intronic
907158988 1:52357822-52357844 TCAGGCAGGCGCTGGGATGAAGG + Exonic
907387678 1:54136611-54136633 TCAGGTAGGGGCTGGGGGAAGGG - Intronic
907401395 1:54227028-54227050 TTATCCAGGAGCTGGTGGGGAGG - Exonic
907451459 1:54548182-54548204 GCGGGCGGGAGCTGGGGAGGAGG + Intronic
907911793 1:58833710-58833732 ACAGTCAGGAGCTGGGGGTGGGG - Intergenic
909672061 1:78200464-78200486 TTAGGAAGGGGATGGGGGGGTGG - Intergenic
910088378 1:83431597-83431619 TCATGAAGGTGCTGGGGTGGAGG - Intergenic
911670831 1:100605622-100605644 TGAGGGAGGGGCTGGGGAGGTGG + Intergenic
912474881 1:109928944-109928966 GCAGGCAGGAGCTCTGGTGGAGG - Exonic
912518957 1:110232433-110232455 TCAGGCAACAGCTGGGGTGATGG + Exonic
912519213 1:110233869-110233891 CCAGGGAGGAGCAGGGAGGGAGG - Exonic
913052243 1:115127798-115127820 TCAGGCTGGAGCTGTGTGGAAGG + Intergenic
913222089 1:116667752-116667774 CCGGGCTGGAGCTGGAGGGGCGG - Exonic
913244580 1:116860361-116860383 GTGGGCAGGAGTTGGGGGGGTGG + Intergenic
914404565 1:147358118-147358140 TCAGGCAGCAGCAGTGGTGGTGG - Intergenic
914460463 1:147878658-147878680 TCAGGCTGGATCTGGGGGTATGG - Intergenic
914876112 1:151513642-151513664 TCTGGCAGGAAGTGGGGGTGGGG - Intronic
915074328 1:153296394-153296416 CCAAGCAGGAGGTGGGTGGGTGG - Intergenic
915163051 1:153933113-153933135 CAAGGCAGGAGATGGGGAGGAGG - Intronic
915218539 1:154355858-154355880 GCAGGCAGGAGGTGAGGAGGGGG + Intergenic
915312300 1:155010793-155010815 TGAGGCTGGAGTTGGGGTGGGGG + Intronic
915454376 1:156029721-156029743 CCAGGTGGGAGCTGGGGGAGGGG + Intergenic
915530192 1:156498863-156498885 TTGGGCAGGAGATGGGGGTGGGG - Intronic
915536735 1:156540965-156540987 TCGGGCAGGGGCTGGTGAGGAGG - Intronic
915662183 1:157413700-157413722 TCAGGCTGGGGCTGGGTGAGAGG - Intergenic
915685105 1:157624685-157624707 TCAGCCAGGATCTGGGGGAGGGG + Intergenic
915991303 1:160519775-160519797 TTTGCCAGGGGCTGGGGGGGAGG + Intronic
916007336 1:160674490-160674512 GCAGGCTGGAGTTGGGGGAGGGG + Intergenic
916090626 1:161305653-161305675 TCTGGCAGGGCCTGGGGTGGGGG + Exonic
916588111 1:166165898-166165920 GTAGGAAGGAGCTGGGGAGGGGG + Intronic
916761145 1:167819038-167819060 TCAGACAGGCTCTGGGGGTGTGG + Intronic
917441514 1:175073000-175073022 TCAGGCTGGGGGTGGGGGGTCGG + Intronic
917594598 1:176516359-176516381 TAAGGCAGGGGATGGGGGAGTGG - Intronic
917751575 1:178058205-178058227 TCAGTCACTAGCTGGGGGGCTGG - Intergenic
918041984 1:180919167-180919189 TAAGGCAGGTGCGGGGGTGGAGG - Intronic
918148653 1:181780030-181780052 CCATCCAGGAGCTGGGAGGGTGG - Intronic
918304608 1:183234639-183234661 TTTGGCAGGAGTTGGGGGTGAGG + Intronic
918605120 1:186415598-186415620 CCAGGCTGAAGCTGGGAGGGAGG - Intronic
919198450 1:194319968-194319990 TCAGGGAGGAGTTGGGGGCAGGG - Intergenic
919833617 1:201558933-201558955 AGAGGCAGGAGTTGGGGTGGGGG + Intergenic
919978836 1:202629855-202629877 GCAGGCAGCTGGTGGGGGGGGGG + Intronic
920223991 1:204424796-204424818 GGTGGCAGGAGCTGGGGGAGAGG - Exonic
920386012 1:205570310-205570332 TCAGCCAGGAGCTGGGACTGGGG - Intronic
920431275 1:205920843-205920865 TCAGACAGAAGCTGCAGGGGAGG + Intronic
921164191 1:212494320-212494342 GCAGGCAGGAGGTGGCGGGAGGG + Intergenic
921252817 1:213313397-213313419 TCAGGAAGGAGTAGGGGAGGTGG - Intergenic
921314380 1:213876436-213876458 TCGGGCAGGGGGTGGGTGGGAGG + Intergenic
921801552 1:219408605-219408627 TCTGGCAGGGGCTGGGGGGGTGG + Intergenic
921982479 1:221273650-221273672 GCAGGCAGGAGCTCAGGGGATGG - Intergenic
922153022 1:223021228-223021250 TCAGGAAGGAGCCAGGGTGGAGG + Intergenic
922229804 1:223675872-223675894 TCATGGAGGTGCTGGGAGGGTGG + Intergenic
922272131 1:224043795-224043817 ACAGGGAGGTGCTGGTGGGGAGG - Intergenic
922493492 1:226037712-226037734 GCTGCCAGGAGCTGGGGGAGAGG + Intergenic
922720672 1:227898796-227898818 TCAGGCAGGTGGTGTGGGTGGGG + Intergenic
922809853 1:228409353-228409375 TCAGGCAGGGGCGGGGGCAGTGG - Intronic
923176757 1:231474346-231474368 TGAAGCAGGAGCCGGGGGTGGGG + Intergenic
923338815 1:232991121-232991143 TCAGGCAGGGATTGGAGGGGAGG + Intronic
923381031 1:233418192-233418214 TGAGGCAGGAGCCTGGGAGGTGG - Intergenic
923473237 1:234310636-234310658 TCAGGAAGGACATGGGTGGGTGG - Intronic
924323110 1:242869311-242869333 ACAGGCATGAGCTGAGGGAGGGG + Intergenic
1062803195 10:395135-395157 GGAGGGAGGAGATGGGGGGGAGG + Intronic
1062844714 10:695441-695463 TGAGGCAGGGGCTGGGGGGCAGG + Intergenic
1062932872 10:1364020-1364042 TCAGGCCTGACCTGGGGGCGCGG - Intronic
1063150685 10:3333619-3333641 AGAGGCAGGAGCTGGTGGGAGGG + Intergenic
1063685980 10:8237573-8237595 TCTGGCAGGAGCAGGGTGTGGGG + Intergenic
1064245034 10:13661431-13661453 CCAGGCAGGGGCTGGTGAGGAGG + Intronic
1064382552 10:14859236-14859258 TGAGGGAGAAGCTGGGGGTGGGG + Intronic
1065811948 10:29450638-29450660 TCTGGCTGGAGGTGGGAGGGAGG - Intergenic
1065959831 10:30725519-30725541 TCTGGCTGGAGGTGGGAGGGAGG + Intergenic
1066206170 10:33191310-33191332 TAAGGCAGGAGGTGGTGGGAGGG + Intronic
1066333592 10:34452581-34452603 TCAGGAAGGAGCAGAGGGGTGGG - Intronic
1066478655 10:35773610-35773632 ACAGGCAGAAGCTGAGTGGGAGG + Intergenic
1067092090 10:43272510-43272532 TCTGGGAGGAGGTGGTGGGGAGG - Intergenic
1067094829 10:43293540-43293562 AGAGTCAGGAGCTGGGCGGGCGG - Intergenic
1067550266 10:47229441-47229463 TCAGTCAGGACCAGTGGGGGTGG + Intergenic
1068555096 10:58449687-58449709 GCAGGCAGAAGCTGGAGTGGGGG - Intergenic
1068654154 10:59557318-59557340 TCAGGCAAGAAGTGGGGGAGGGG + Intergenic
1069051192 10:63796399-63796421 TCAGGCAGGTCCTTTGGGGGAGG + Intergenic
1069452220 10:68527017-68527039 TCCGGCAGAGGCTGGGGAGGTGG - Intronic
1069714287 10:70510603-70510625 TCAGGAAGGAGCAGAGGGAGGGG - Intronic
1069728675 10:70597580-70597602 TCAGCCAGGAGCTGGGCAGAAGG - Exonic
1069776393 10:70929678-70929700 TCATCCAGGAGTTGGGGTGGGGG + Intergenic
1069795765 10:71050832-71050854 TCAGGCAGGATCAAGGGTGGAGG - Intergenic
1069842010 10:71345816-71345838 GCAGGCAGGAGCAGGAGGCGAGG + Intronic
1069976310 10:72216087-72216109 TCAGGCTGGTCCTGGGGGTGGGG + Exonic
1070309420 10:75262661-75262683 TCAGGGAGGGGCGGGGGGGTGGG - Intergenic
1070843295 10:79502892-79502914 GCCGGCAGGAGGTGGAGGGGGGG - Intergenic
1071294644 10:84210989-84211011 ACAGCCAGGAGCTGGGAAGGGGG - Exonic
1071568330 10:86682939-86682961 TCTAGAAAGAGCTGGGGGGGTGG - Intronic
1072033305 10:91541551-91541573 ACAGGAAGGAGCAGCGGGGGAGG + Intergenic
1072059619 10:91797482-91797504 TAAGGTAGGAGGTTGGGGGGGGG + Intergenic
1072675236 10:97460703-97460725 TAAGGCAGGAGCTGAGAGGATGG + Exonic
1073098534 10:100995310-100995332 TGAGGAAGAACCTGGGGGGGTGG + Intergenic
1073129977 10:101181900-101181922 TGCTGCAGGAGCTGAGGGGGTGG + Intergenic
1073250604 10:102118546-102118568 TCAGGCTGGAGGTGGATGGGAGG - Intronic
1073267248 10:102235177-102235199 CCAGGGAGGCGGTGGGGGGGTGG - Intronic
1073533597 10:104254941-104254963 TCAGCCAGGAGCTTGGGGAAGGG + Exonic
1074378094 10:112955094-112955116 TCAGGGGTGAGGTGGGGGGGTGG - Intronic
1074638291 10:115346259-115346281 TCTGGAAGGAGGTGGGGGAGTGG - Intronic
1075536284 10:123274973-123274995 TTAGGGAGGAGGTGGGAGGGTGG - Intergenic
1075547934 10:123369506-123369528 CCAGCCAGAAGCTGGGGGTGGGG + Intergenic
1075728494 10:124622846-124622868 TCAGGGAGGGCCTGGGGTGGGGG - Exonic
1075995327 10:126872228-126872250 TCATGCAGGCCCTGGGGGGCTGG + Intergenic
1076066851 10:127455593-127455615 TCAGGCAGGAGCTGATGCTGCGG - Intergenic
1076202102 10:128567024-128567046 GCAGGCAGGGGCAGGGAGGGAGG - Intergenic
1076358438 10:129869398-129869420 AAAGCCAGGAGCTGGCGGGGTGG - Intronic
1076648839 10:131973248-131973270 TCTGGCAGGTGCTGGGTGGAAGG - Intronic
1076824823 10:132961618-132961640 GCAGGCATGAGGTGGGGGTGAGG - Intergenic
1076902023 10:133344223-133344245 TCAGGCAGGACCGGGCGCGGTGG - Intronic
1076907906 10:133372673-133372695 CCAGGCAGGGGGTGGGGGTGCGG + Intronic
1076983933 11:222242-222264 AGAGGCAGGAGCTGGGGTGCTGG - Intronic
1076996444 11:299517-299539 TCAGACTGGTGCTGGGAGGGTGG + Exonic
1077143989 11:1036759-1036781 GCAGGCAGGTGCGGCGGGGGAGG - Intergenic
1077154591 11:1085676-1085698 TCAGGCAGGCCCGGGAGGGGTGG - Intergenic
1077223330 11:1426916-1426938 GCATGCGGGAGATGGGGGGGCGG + Intronic
1077309645 11:1882667-1882689 CCAGGCAGGTGCAGGGGGTGGGG - Intronic
1077328807 11:1975042-1975064 CCAGGCTGGAGCTCTGGGGGCGG - Intronic
1077384598 11:2263034-2263056 ACAGCCAGCAGCTGGGGAGGGGG + Intergenic
1077405575 11:2381046-2381068 CCTGGCAGGCGCTGTGGGGGAGG + Intronic
1077421743 11:2453738-2453760 TCAGGTAGGTTCTGGGGAGGGGG - Intronic
1077479183 11:2805233-2805255 CCAGGCTGGAGCTGGGGGAAAGG - Intronic
1077806596 11:5596558-5596580 CCAGGCTGGAGATGGGGGAGGGG - Intronic
1078078963 11:8190291-8190313 TCAGGAAGCAGGTGTGGGGGGGG - Intergenic
1078152914 11:8774580-8774602 ACAGCCAGGAGTTGGGGTGGTGG - Intronic
1078171975 11:8934985-8935007 TCAGGCAGGAGATGACGGGGTGG + Intergenic
1078190858 11:9091646-9091668 TGAGGCCGGGGCTCGGGGGGCGG - Intronic
1078535946 11:12174359-12174381 GTAGGCAGGGGCTGGGGGTGGGG - Intronic
1078552579 11:12290645-12290667 GCAGGAAGGAGCTGCTGGGGAGG - Intronic
1078639284 11:13080317-13080339 TGAGGCAGGGGCTGGCTGGGGGG - Intergenic
1078715658 11:13836753-13836775 TAAGGAAGTAGCTTGGGGGGTGG + Intergenic
1078758661 11:14234349-14234371 TCAGGTAGAAGATGGGGAGGCGG + Intronic
1078839238 11:15062868-15062890 CCAGGCAGGAGCTGGGTGCTGGG + Intronic
1078893556 11:15578696-15578718 TCAGCCAGGAGCTGGAGGGTAGG + Intergenic
1079111741 11:17609155-17609177 TCATCCAGGACCTGGGGGGTGGG - Exonic
1079237053 11:18698686-18698708 GCGGGCGGGAGCCGGGGGGGCGG - Intronic
1079334088 11:19555851-19555873 TCAGGCTGGGGCTGGGGCTGGGG - Intronic
1079343585 11:19633144-19633166 ACAGGGAGGAGCTGGGGGCACGG - Intronic
1080579569 11:33631295-33631317 TCAGGCTGGAGCCAAGGGGGTGG - Intronic
1080590953 11:33722780-33722802 TCAGCCAGCAGCTTGGGGTGGGG - Intronic
1080701670 11:34649579-34649601 TAAGGCAGGAGCTGGGTTGCAGG - Intronic
1081529441 11:43947886-43947908 GCAGGCATGAGCTGGGTGGGTGG + Intergenic
1081655455 11:44854188-44854210 TGGGGCAGGGGGTGGGGGGGGGG + Intronic
1081669133 11:44933547-44933569 TCAGGGAGAAGCTGGGCGGTGGG + Exonic
1081669146 11:44933594-44933616 TCAGGGAGAAGCTGGGCGGTGGG + Exonic
1081975481 11:47231852-47231874 TCAGCCAGGGGCTGGGGGCGAGG + Intronic
1082091765 11:48096260-48096282 TCTGCCAGGCGCTGGGGGTGGGG + Intronic
1082870244 11:57937603-57937625 TCAGGAAGGAGCTGAGAAGGAGG + Intergenic
1082932424 11:58622605-58622627 TCAGGCAGGGCGTGGGGGTGGGG + Intronic
1083162662 11:60864925-60864947 CCAGGCAGGAGCGGGGAGTGGGG - Intergenic
1083281474 11:61629621-61629643 CCAGGCAGGCCCTGGGGGAGGGG + Intergenic
1083288508 11:61676548-61676570 GCAGACAGGAGCTGGGGAGGAGG - Intergenic
1083305655 11:61760911-61760933 TCAGGCAGCAGCTGAGGGCCAGG - Intronic
1083373324 11:62199183-62199205 TCAGGCTGGGGCAGGGAGGGAGG + Intergenic
1083464959 11:62839284-62839306 TCGGGCCGGAGCTGGGGGCCTGG - Intronic
1083614947 11:64021641-64021663 CCAGCCAGGAGTTGGGGGGGTGG + Intronic
1083654016 11:64220355-64220377 CCGGGCAGGAGCTGGGGCAGGGG + Intronic
1083883165 11:65558200-65558222 TCAGGCAGGAGCGAGGAGGCCGG + Exonic
1084038952 11:66530616-66530638 ACAGGCAGGGGGTGGGGGTGAGG + Intronic
1084105791 11:66979455-66979477 TCAGCTAGGAGCTGGGCTGGGGG - Intergenic
1084166110 11:67375457-67375479 GCAGGGAGGAGGTGCGGGGGCGG - Intronic
1084312626 11:68325710-68325732 TCAGGCAGGAACGGGTGAGGGGG - Intronic
1084336441 11:68460649-68460671 TGAGCCTGGAGCTGGGGGCGGGG + Intergenic
1084597255 11:70124338-70124360 TCGTACAGGAGCTGAGGGGGAGG - Exonic
1084716715 11:70878890-70878912 TCTGGCTGGAGCTGGAGGTGAGG - Intronic
1084868539 11:72080271-72080293 AGAGGGAGGAGCCGGGGGGGGGG - Intronic
1084947804 11:72648275-72648297 TCTGGCAGGTGCTGAGGTGGAGG - Intronic
1085062704 11:73462425-73462447 ATTGCCAGGAGCTGGGGGGGAGG + Intronic
1085254387 11:75164220-75164242 TCAGGCAGGCGCTGGGACAGGGG - Intronic
1085304463 11:75477265-75477287 ACAGGCAGGTGCTGGAGGAGAGG - Intronic
1085341386 11:75733708-75733730 CCAGGCTGGGGCTGGGGCGGGGG + Intergenic
1085399146 11:76225201-76225223 TCAGGGAGCAGCTGAGGGCGGGG + Intergenic
1085830728 11:79898051-79898073 TTAGGCAGTTGCTGGGGCGGGGG + Intergenic
1085835188 11:79948258-79948280 TCAAGCAGGAGCTGTGAAGGTGG - Intergenic
1087104148 11:94393930-94393952 TCAGGTAGCTGCTGGGGGAGAGG + Intronic
1087120691 11:94571043-94571065 TCAGACATGAGATGGGTGGGGGG - Intronic
1088332172 11:108665341-108665363 TGAGGCCGGCGCTGGGGAGGGGG + Intronic
1088385847 11:109254903-109254925 TGTGGCAGGAGTTGGGGAGGGGG - Intergenic
1088501812 11:110490816-110490838 CCAGACAGGAGCTGGTGGGATGG + Intergenic
1088601865 11:111486967-111486989 TCAGGGAGGAGGCGGGGGGAGGG - Intronic
1088892513 11:114056393-114056415 TCAGGCAGAAATTGGGGAGGGGG - Intergenic
1089401370 11:118166494-118166516 TCAGAGAGGACCTGGTGGGGAGG - Exonic
1089491408 11:118886467-118886489 TAAGGCAGGGGCTGGGGGGTGGG + Intronic
1089560608 11:119341360-119341382 ACAGGAAGGAGCAGGGAGGGTGG + Exonic
1089567862 11:119381584-119381606 TCAGGCAGGAGCCGAGGCCGGGG - Exonic
1089583674 11:119496849-119496871 TCAGGGAGGGGCAGGGGAGGTGG + Intergenic
1089665199 11:120013818-120013840 AAAGGCAGGAGCCGGGGGGTGGG - Intergenic
1089848916 11:121480598-121480620 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089848940 11:121480706-121480728 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089848952 11:121480760-121480782 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089848964 11:121480814-121480836 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089848984 11:121480922-121480944 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089848996 11:121480976-121480998 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849008 11:121481030-121481052 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849020 11:121481084-121481106 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849050 11:121481246-121481268 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849063 11:121481300-121481322 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849094 11:121481462-121481484 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849106 11:121481516-121481538 TAGGGAAGGAGCTGGGGAGGAGG - Intronic
1089849117 11:121481570-121481592 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849140 11:121481672-121481694 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849152 11:121481726-121481748 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849164 11:121481780-121481802 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849176 11:121481834-121481856 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1089849188 11:121481888-121481910 TAGGGGAGGAGCTGGGGAGGAGG - Intronic
1090029090 11:123192756-123192778 TCAAACAGGGGCTGGGAGGGTGG - Intronic
1090058631 11:123444739-123444761 TCGTGCAGGTGCTGGGAGGGTGG - Intergenic
1090376120 11:126290908-126290930 AGAGCCAGGAGCTGGGAGGGAGG - Exonic
1090477672 11:127038170-127038192 TCAGGTAGGGGCTGGGGGGAGGG + Intergenic
1090860004 11:130644576-130644598 TGAGGCAGGAGCAAGGGCGGAGG - Intergenic
1090954511 11:131502498-131502520 GGAGGCAGGAGCTGGGAGCGGGG + Intronic
1202811786 11_KI270721v1_random:30221-30243 CCAGGCTGGAGCTCTGGGGGCGG - Intergenic
1091583235 12:1801158-1801180 TGAGGCAGGGGCAGGGGGTGGGG - Intronic
1091917951 12:4282734-4282756 GCTGGGAGGAGCTGGGGAGGGGG - Intronic
1092127391 12:6084517-6084539 TCAGGCGGGTGCAGGGGAGGAGG + Intronic
1094828849 12:34290691-34290713 TCAGGCAGGGGCTGCTGGGATGG + Intergenic
1094834379 12:34315420-34315442 CCAGGCAGGAGCTGCTGGGAAGG + Intergenic
1096244854 12:49978777-49978799 CCAGGCAGGGGCTGGGGAGAGGG + Intronic
1096509809 12:52121524-52121546 TGCGGCTGGAGCTGGGGGGACGG - Intergenic
1096671157 12:53198974-53198996 CCAGGCTGGAGCTGGGGAGCTGG - Intronic
1096673652 12:53214857-53214879 CCCTGCAGGAGCTGGGGGAGGGG + Intronic
1096775299 12:53960036-53960058 GCAGCCATGAGCTGGGGGAGGGG + Intergenic
1096794055 12:54062943-54062965 TCAGGATGGAGCTGGAGGGAAGG - Intergenic
1096846769 12:54411796-54411818 TCAGGGAGGGACTGGGGGGTGGG - Intronic
1097167688 12:57094322-57094344 TCTGTCAGGAGCTGCGGGGGTGG - Intronic
1097180134 12:57167070-57167092 TCAGGCTGGGCCTGGGGGAGGGG + Intronic
1097182680 12:57180158-57180180 TTAGGGAGGGGCTGTGGGGGTGG - Intronic
1097230371 12:57507485-57507507 GCAGGAGGGAGGTGGGGGGGGGG - Intronic
1097243299 12:57591109-57591131 GCAGGCAGGCGCCGGGGGGCGGG + Intergenic
1097697231 12:62786484-62786506 TCAGGCAAGAGATGGGAGGGCGG + Intronic
1099450708 12:82803296-82803318 CCAGGCAGGAGCTGGGCTAGAGG + Intronic
1099878061 12:88433880-88433902 TAAGGCAGAAGCTGGGGGCTGGG + Intergenic
1100316324 12:93448104-93448126 ACAGGCAGTAGGTGGGGTGGGGG + Intergenic
1100531539 12:95466236-95466258 TGAGGAATGAGTTGGGGGGGTGG - Intergenic
1101909233 12:108850032-108850054 CCAGGAAGGAGCTGGGGGAGGGG + Intronic
1101909271 12:108850128-108850150 CCAGGAGGGAGCTGGGGGAGGGG + Intronic
1101909320 12:108850248-108850270 CCAGGAGGGAGCTGGGGGAGGGG + Intronic
1101910564 12:108857652-108857674 GGAGGCGGGAGCTGGGGGCGGGG - Intergenic
1102480588 12:113220851-113220873 TAAGGCAGGAGCTGAGGGACAGG + Intronic
1102690815 12:114759244-114759266 GCTGCCAGGAGCTGGGGGTGGGG + Intergenic
1102702027 12:114847697-114847719 CCAAACAGGAGTTGGGGGGGTGG + Intergenic
1103008288 12:117439023-117439045 GGAGGCCGGAGCTGAGGGGGAGG - Intronic
1103524767 12:121560465-121560487 TGATGCAGGAGGTGGGTGGGGGG + Intronic
1103973711 12:124688418-124688440 TCTGGGAGGAAATGGGGGGGGGG - Intergenic
1104042626 12:125140247-125140269 TCATGCAGGAGCTGGTGTGGGGG + Intronic
1104140597 12:125983439-125983461 TCTGGGAGGAGCCTGGGGGGGGG - Intergenic
1104267155 12:127244277-127244299 GCAGGGAGCAGCTGGGAGGGGGG + Intergenic
1104754415 12:131260212-131260234 CCAGGCAGGAGTTGGCGGGCAGG - Intergenic
1104900826 12:132188800-132188822 TCAGGCTGGAGGTGGGGGCAGGG + Intergenic
1104900875 12:132189008-132189030 TCAGGACAGAGCTGGGGAGGTGG - Intergenic
1105012598 12:132765679-132765701 ACAGGCAGGTGGCGGGGGGGGGG + Intergenic
1105616025 13:22013512-22013534 TCTGGAAGGAGATGGGGAGGTGG - Intergenic
1105625676 13:22110475-22110497 GCAGCCTGGAGCTGGGGCGGGGG + Intergenic
1105636480 13:22220527-22220549 GCAGGGAGGGGCTGGGGTGGCGG - Intergenic
1105997710 13:25688000-25688022 TCAGGAAGGTGCTGGAGGGTGGG - Intronic
1106021419 13:25919544-25919566 TAGGGCAGGAGCTGGAGGAGGGG - Intronic
1106340098 13:28819762-28819784 TGAGGCGGGAGCTGGGGCGGGGG + Intergenic
1106458802 13:29950151-29950173 GTAGGCAAGAGCTGGGGAGGAGG + Intergenic
1106582428 13:31029633-31029655 GCAGGAAGGGGCTGGTGGGGGGG + Intergenic
1107443527 13:40449396-40449418 TCAGGTTGGAGCTGGGGAAGAGG + Intergenic
1107484584 13:40813661-40813683 TCAGGCAGGAGCTGTGCTGGGGG - Intergenic
1107821028 13:44285839-44285861 TCATGCAGGACCTGAGGGGCTGG - Intergenic
1108453883 13:50594500-50594522 TCAGGCGGGGGCGGGTGGGGGGG + Intronic
1108485206 13:50916857-50916879 CCAGGAAGGAGCAGGGGTGGTGG + Intronic
1108586072 13:51871022-51871044 CCAGGCGGGAGTTGGGGAGGAGG - Intergenic
1109540801 13:63776588-63776610 CCTGTCAGGAGGTGGGGGGGGGG - Intergenic
1110309799 13:74036044-74036066 TGAGGCAGGAGCTGGGGATGTGG - Intronic
1111446741 13:88355837-88355859 TCTGCCAGGAGTTGGGGGGAAGG - Intergenic
1111493861 13:89022421-89022443 TCTGTCAGGGGCTGGGGGGCTGG - Intergenic
1112917752 13:104572199-104572221 AGAGGCAGGTGCTGGGGGAGAGG - Intergenic
1112960469 13:105119707-105119729 TCATGCAGGAGCAGGGTGTGTGG + Intergenic
1113366816 13:109684168-109684190 GCTGGCAGGGGCTGGGGGGAGGG - Intergenic
1113468061 13:110525793-110525815 TCAGGAAGCAGCTGTGGGAGAGG + Intronic
1113494185 13:110714554-110714576 TGAGGCGGGTGCTGCGGGGGAGG + Intronic
1113744522 13:112734261-112734283 TGAGGCAGGTGCAGGGGGCGGGG + Intronic
1113766851 13:112887413-112887435 TCAGGGAGGAGCTTGTGGTGGGG - Intergenic
1113885209 13:113655256-113655278 TCCTGCTGGAGCTGGGGTGGTGG - Intronic
1114271638 14:21103814-21103836 TCGGGGAGGAGCCGGGCGGGCGG + Intronic
1114516996 14:23306838-23306860 TGGTGCAGGAGCTGGGAGGGAGG - Exonic
1114696952 14:24634314-24634336 TCAGGCAGAGGCAGTGGGGGTGG - Intergenic
1115116893 14:29891409-29891431 TGAGGCAGGAGGTGGATGGGAGG - Intronic
1115170697 14:30502826-30502848 TGAGGCAGGGGTTGGGGGTGGGG - Intergenic
1116857414 14:49965222-49965244 TTTGGCAGGAGCTGGGGGAAGGG + Intergenic
1116940544 14:50786382-50786404 TCTGGAAGGAGGTGGGGGTGGGG + Intronic
1117327847 14:54685276-54685298 GCTGCCAGGAGCTGGGGGGGGGG - Intronic
1117495063 14:56294590-56294612 AGAGCCAGGAGCTGGGGTGGAGG - Intronic
1118220874 14:63853467-63853489 TCGGGCAGGCGCTGCGCGGGAGG + Intronic
1118383044 14:65233385-65233407 GCAGGGAGGAGATGGGGGAGAGG - Intergenic
1118979155 14:70701969-70701991 GCAGGAAGGACCTGGAGGGGTGG - Intergenic
1119133079 14:72192605-72192627 TAAGGGAGGAGCAGGAGGGGAGG - Intronic
1119264234 14:73254707-73254729 TCAGGCAGCAGGTGTGGGGGTGG - Intronic
1119384210 14:74247006-74247028 GCAGGAAGGAGCTTGGGGTGTGG + Intronic
1119750994 14:77077200-77077222 CAAGGCAGGAGCTGGGGCTGCGG + Intergenic
1119851831 14:77871726-77871748 TCATGCAGGAGCTGAAGGGGAGG + Intronic
1119881107 14:78100705-78100727 ACAGGGAGGTGCTGGGAGGGTGG - Intergenic
1121001791 14:90456375-90456397 GCAGACAGGAGCTGGGGAGAGGG + Intergenic
1121309501 14:92928020-92928042 CCTGGAAGGAGCTGGGGGGCTGG - Intronic
1121323743 14:93007804-93007826 TCAGGGAGGAGCTCCTGGGGCGG - Intronic
1121570012 14:94940449-94940471 TGAGGCAGGGGCTGGGGGTGGGG + Intergenic
1122290217 14:100676753-100676775 CCAGGCAGGAGCTTGAGGGGCGG - Intergenic
1122350138 14:101084254-101084276 GCAGGCAGGTGCTGAGAGGGAGG + Intergenic
1122637677 14:103138076-103138098 ACAGCCCGGAGCTGGGGGTGGGG + Intergenic
1122805359 14:104253661-104253683 TCAGGCGGGAGCTGAGGGAGTGG + Intergenic
1122809628 14:104281591-104281613 TCAGACAGATGCTGGGGTGGGGG - Intergenic
1122903622 14:104792171-104792193 TCAGGCCTGAGCTTTGGGGGTGG - Intronic
1122907004 14:104806213-104806235 GTGGGCAGGAGCTGGGGAGGTGG - Intergenic
1122917751 14:104866521-104866543 TCTGGCTGGAGCTGGGTGCGTGG + Intronic
1122940445 14:104978681-104978703 TTAGTCAGAAGCTGGGGTGGGGG + Intergenic
1122972811 14:105159232-105159254 GCAGGCAGGGGCTCGGGGGCGGG - Intronic
1123019683 14:105391803-105391825 TCAGGCAGCATGTGGTGGGGCGG - Intronic
1123479250 15:20615998-20616020 TGTGGCAGGAGCTGAGAGGGCGG + Intergenic
1123638763 15:22384387-22384409 TGTGGCAGGAGCTGAGAGGGCGG - Intergenic
1123898046 15:24848200-24848222 ACAGGACGGAGCTGGGGGGCGGG + Intronic
1124586564 15:31014989-31015011 TGAGGCAGGGGGTGGGGGTGGGG + Intronic
1124904849 15:33858673-33858695 TCAGGTTGGAGGTGGGGAGGGGG + Intronic
1125502540 15:40248484-40248506 TCAAGCAGGACCTGCCGGGGAGG - Intronic
1125598870 15:40904714-40904736 CCAGGCAGGAGCTGGGAAGGCGG - Intergenic
1125609358 15:40960324-40960346 AAAGGCAGGAGCTGGGACGGTGG + Intergenic
1127264037 15:57346845-57346867 TCAGTCAGAATCTGGGGTGGGGG + Intergenic
1127317152 15:57808060-57808082 TATGGCAGGGGCTGTGGGGGAGG - Intergenic
1128223054 15:65982211-65982233 TGCGGCAGGACCTGGAGGGGCGG - Intronic
1128345062 15:66848322-66848344 TCAGGCAGGGGTCGGAGGGGAGG - Intergenic
1128412557 15:67414125-67414147 TCAGGAAGCAGCTGGAGGGAAGG - Intronic
1128526875 15:68418565-68418587 TCAGGAAGGGGGTGGGGGGGTGG - Intronic
1128542425 15:68545381-68545403 AGAGGCTGGAGCTGGGGGAGGGG - Intergenic
1128545081 15:68561270-68561292 CCTGGGAGGAGCTGGGAGGGGGG - Intergenic
1128635604 15:69300148-69300170 ACAGGCAGAACCTAGGGGGGTGG - Intronic
1129168243 15:73791517-73791539 GCAGGCATGAGCTGGGGATGGGG + Intergenic
1129176953 15:73847222-73847244 TGAGCCAGGTGCTGTGGGGGAGG - Intergenic
1129316908 15:74750623-74750645 GCATGCTGGAGCTGGGAGGGAGG - Intronic
1129371392 15:75098142-75098164 TGAGGCAGGAGCTGTGGCTGAGG + Intronic
1129447028 15:75625747-75625769 TGAGGCAGCAGCTGGGGGCGGGG - Intronic
1129606068 15:77025606-77025628 TGAGGCAGGTGCAGGGGGCGGGG + Intronic
1129679374 15:77649579-77649601 TCAGGAAGGAGCTGAGGGGTAGG + Intronic
1129741523 15:77991923-77991945 TCTGCCTGGAGCTGGGGTGGAGG + Intronic
1129771756 15:78207266-78207288 TCTGGCCTGAGCTGTGGGGGTGG - Intronic
1129775696 15:78234978-78235000 CCATGCAGGACCTGGGGGAGGGG - Intronic
1129844136 15:78760481-78760503 TCTGCCTGGAGCTGGGGTGGAGG - Intronic
1129853788 15:78810632-78810654 GTGGGCGGGAGCTGGGGGGGCGG + Intronic
1129875671 15:78973846-78973868 ACTGGCAGGAGTTGGGGGGCTGG - Intronic
1130000589 15:80043330-80043352 ACTGGCAGGAGATGGGAGGGAGG - Intergenic
1130257670 15:82333319-82333341 TCTGCCTGGAGCTGGGGTGGAGG + Intergenic
1130597270 15:85256644-85256666 TCTGCCTGGAGCTGGGGTGGAGG - Intergenic
1131227984 15:90640898-90640920 GCAGGCAGACGCTGGGGTGGAGG - Intronic
1131269979 15:90941337-90941359 TCAGGTAAGAGCTGGGGGCATGG - Intronic
1131460912 15:92616947-92616969 TCACCAAGGAGCTGGGGGTGTGG - Intergenic
1131854870 15:96582866-96582888 GCAGGCAGGAGCTGGTGGGGAGG - Intergenic
1132478548 16:154260-154282 TGGGACAGGAGCTGGGGGCGGGG - Exonic
1132480726 16:165016-165038 TGGGACAGGAGCTGGGGGCGGGG - Intronic
1132653292 16:1031118-1031140 TCAGCCAGGACCTGGGTGTGGGG + Intergenic
1132784651 16:1649273-1649295 TCAGTCAGTAGTTGGGTGGGTGG + Intronic
1133034720 16:3028351-3028373 TCACGCAGGAGCTGGAGGCCTGG - Exonic
1133063293 16:3189000-3189022 CCAGGCAGGCGCTGCGGGGCTGG + Intergenic
1133103577 16:3493533-3493555 TCAGGGAGGCGGTGGCGGGGGGG + Exonic
1133238851 16:4403006-4403028 CCAGGAAGGAGATGGGGCGGGGG + Intronic
1133283757 16:4681197-4681219 ACAGACAGGAGCTGGGAGCGGGG - Intronic
1134016425 16:10891663-10891685 TCAGGCAGGAGCTGGGGCAAAGG + Intronic
1134451826 16:14368445-14368467 CCAGGCTTGAGCTGGGGTGGTGG + Intergenic
1135435092 16:22421244-22421266 TCAGGATGGAGCTGGTGGTGGGG - Intronic
1135483539 16:22843668-22843690 TCATCCACGAGCTGGGGTGGGGG - Intronic
1135556053 16:23437455-23437477 TAAGGCTGGAGCTGGGGGGTTGG - Intronic
1135587774 16:23683989-23684011 TCAGGCAGGTGATGGGGAGACGG - Exonic
1136072772 16:27798284-27798306 TCTGCCAGGAGCTGGGGAGGGGG + Intronic
1136403044 16:30028849-30028871 GCAGGCAGGAGGCGGGGGGACGG - Intronic
1136471510 16:30483838-30483860 TCCGGGAGGAGCTGGGGGCCCGG + Exonic
1136519125 16:30785091-30785113 TCAGGCTGGAGGTGGGGAGAGGG + Intronic
1136632523 16:31497224-31497246 CCAAGCAGGAGCTGGAGGGCTGG - Intronic
1137024630 16:35460364-35460386 TCACGCAGGACCTGAAGGGGAGG - Intergenic
1137607714 16:49797549-49797571 TCAGGCAGTGGGTGGGGTGGGGG + Intronic
1138116178 16:54362408-54362430 CCAGGCTGGGGCTGGGGGTGGGG + Intergenic
1138143139 16:54585712-54585734 ACAGGCGGGAGTTGGGGGTGCGG + Intergenic
1138225684 16:55292404-55292426 TAAGGGAGTAGCTGGGGAGGGGG + Intergenic
1138265685 16:55657880-55657902 TCAGGAAGGAGCTAGGGGGTGGG - Intronic
1138273318 16:55711844-55711866 TCAGGCAGGAGGAAGGGGGAGGG + Intergenic
1138309913 16:56014703-56014725 TGGGGCAGGAGCTGTGAGGGGGG + Intergenic
1138540300 16:57683809-57683831 GCAGGCAGGAGCTGGCAGTGGGG + Intronic
1139775941 16:69317048-69317070 CCAGGCAGGAGAGGGGTGGGTGG + Intronic
1140031208 16:71340692-71340714 GCAGACAGGAGGTGGGAGGGCGG - Intergenic
1141067470 16:80925684-80925706 TCAGGCAGGAGCGGGCTGGGTGG + Intergenic
1141108134 16:81250298-81250320 GGAGGCAGGAGCTGGTGGGAAGG - Intronic
1141629082 16:85277081-85277103 TGGGGAAGGAGCTGGGGGAGGGG + Intergenic
1141983140 16:87562206-87562228 ACAGACATGAGCTGGGGGTGCGG - Intergenic
1142034267 16:87854074-87854096 TCAGGCTGGCGGTGGGGGGGGGG - Intronic
1142044281 16:87915019-87915041 TCAGGATGGAGCTGGTGGTGCGG - Intronic
1142123966 16:88401039-88401061 TCAGGGAGGGGCTGGGGTGGAGG - Intergenic
1142146175 16:88493748-88493770 CCAGGAAGGGGCTGGGGTGGGGG - Intronic
1142249891 16:88986388-88986410 TCAGGCATGTGCTGCAGGGGGGG + Intergenic
1142343523 16:89538981-89539003 CCAGGCAGGAGCTAAGGGGTGGG + Intronic
1142409261 16:89907901-89907923 GGAGGCAGGAGCTGGGAGGTGGG - Intronic
1142414623 16:89934657-89934679 TCAGGCAGGGGCTGGAGGTCTGG + Intronic
1142600809 17:1052588-1052610 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142600827 17:1052632-1052654 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142600912 17:1052852-1052874 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142600946 17:1052940-1052962 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142600996 17:1053072-1053094 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142601014 17:1053116-1053138 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142601032 17:1053160-1053182 TCCGGAAGGGGCTGGGGGAGGGG + Intronic
1142667431 17:1470880-1470902 TGGGGCTGGAGCTGGTGGGGAGG + Intronic
1142711598 17:1726718-1726740 CCAGCCAGGCGCTGGGGGTGTGG - Exonic
1142764044 17:2056015-2056037 GCAGGAAGCAGGTGGGGGGGAGG - Intronic
1142913107 17:3112516-3112538 CCAGGAGGGAGGTGGGGGGGGGG - Intergenic
1143016197 17:3892506-3892528 TCCTGCAGGAGCCGGGGGCGGGG - Intronic
1143151349 17:4809055-4809077 TCAGGTAAGAGCTGGGAGGCTGG - Intronic
1143457861 17:7079277-7079299 TGAAGTAGGAGCTGGGTGGGGGG + Intronic
1143478845 17:7217452-7217474 TGGGGCATGAGCTGGGGTGGGGG + Intronic
1143510105 17:7390598-7390620 ACAGGCAGGAGGTGGGGGCAGGG + Intronic
1143518175 17:7430289-7430311 TCCGGGAGGAGCTGGGGCAGAGG - Intergenic
1143548585 17:7614806-7614828 TGAGGCAGCAGCGGGGGCGGCGG - Exonic
1143587143 17:7855957-7855979 TCACGACGGAGCTGAGGGGGAGG - Exonic
1143642132 17:8205159-8205181 GAAGCCAGGAGCTGGGGGGCTGG - Intronic
1144457393 17:15430305-15430327 TCAGGGAGGAGATGGGTGGCCGG + Intergenic
1144504308 17:15817272-15817294 GCAGGCAGGAGCTGCCGGCGTGG - Intergenic
1144634061 17:16892940-16892962 GCAGGCAGGAGCTGCCGGCGTGG - Intergenic
1144781677 17:17811524-17811546 GAAGGGAGGGGCTGGGGGGGGGG + Intronic
1144944244 17:18961682-18961704 TCAGCCAGGAGCTGTGGGCAGGG + Intronic
1145168165 17:20632781-20632803 GCAGGCAGGAGCTGCCGGCGTGG - Intergenic
1145213947 17:21038333-21038355 TCAGCCAGGTGCTGGGATGGTGG - Intronic
1145249126 17:21287911-21287933 ACAGCCAGGGGTTGGGGGGGTGG - Intronic
1145739698 17:27262892-27262914 TCAATCAGGAGCTGGGGGTGTGG + Intergenic
1145743483 17:27294990-27295012 TAAGGGAGGAGCTGGGTGGTTGG + Intronic
1145758210 17:27408368-27408390 GCAGGCTGGAGCTGGGCAGGTGG - Intergenic
1145887953 17:28395968-28395990 TCAGGCAGGACCTGGGGCTCAGG - Exonic
1146164249 17:30575749-30575771 GCAGGCAGGAGCTGCCGGCGTGG - Intergenic
1146637518 17:34517474-34517496 TCAGGCAGGATCTATGGTGGGGG + Intergenic
1146757779 17:35448573-35448595 GCTGGCCGGAGCTGGGGGGCGGG + Intronic
1146948331 17:36889069-36889091 CCAAGGAGGAGCTGGGGGGAGGG + Intergenic
1147318274 17:39631503-39631525 CCAGGCAGGAGTTGAGGTGGGGG - Intronic
1147421417 17:40323821-40323843 TGAGGCAGGACTTGGTGGGGGGG + Intronic
1147445212 17:40471175-40471197 TTGGCCAGGAGCTGGGGGAGGGG - Intergenic
1147673578 17:42190596-42190618 GTAGGCAGGAGCCGGTGGGGAGG + Intronic
1148110065 17:45139300-45139322 ACAGGCAGGAGGTGGGGGTGAGG + Intronic
1148202820 17:45761133-45761155 TGAGGCATGAGCTGGTGCGGTGG - Intergenic
1148217535 17:45841305-45841327 GCGGGCAGGGGCTGGGGGAGGGG - Intergenic
1148455873 17:47811136-47811158 TCAGGCAGGGCATGGGGTGGAGG - Intronic
1148504943 17:48119923-48119945 GTTGCCAGGAGCTGGGGGGGAGG - Intronic
1149602684 17:57903459-57903481 TCAGGAAGGAGCTAGGAGGGTGG + Intronic
1150006119 17:61470057-61470079 TTGGGCAGGAGTTGGGGGTGAGG - Intronic
1150565070 17:66331592-66331614 TCTTTCAGGAGCTGGGGAGGAGG + Intronic
1151323249 17:73364098-73364120 CCAGCCAGGTGCTGGGGGTGTGG - Intronic
1151340097 17:73465592-73465614 ACAGGAAGGGGCTGGGGAGGGGG + Intronic
1151347123 17:73508961-73508983 TGAGGCAGCAGCCGGCGGGGAGG + Intronic
1151359064 17:73577617-73577639 AGAGGCAGGTGCTGTGGGGGAGG + Intronic
1151453734 17:74214220-74214242 GCAGGCCGGGGCTGGGGAGGAGG - Intronic
1151461172 17:74254972-74254994 TCTGGCTGGAGGTGGTGGGGTGG - Intronic
1151656389 17:75498216-75498238 TGAGGCAGGAGCTGATGGTGAGG - Exonic
1151661930 17:75523801-75523823 ACTGGCAGCAGCTGGGGGAGGGG - Intronic
1151711406 17:75809073-75809095 ACAGGCTGGAGCGGCGGGGGCGG + Intronic
1151832791 17:76565183-76565205 CAAGGCAGCAGCTGGGGGGGAGG - Intronic
1151947916 17:77329543-77329565 CAAGGCAGGAGCTGGGGTGTTGG + Intronic
1151956406 17:77382406-77382428 TCAGGTGGGAGGTGGGGGAGAGG + Intronic
1152032449 17:77852850-77852872 GTGGGCAGGAGCTGGGGTGGAGG + Intergenic
1152151549 17:78604336-78604358 TCAGGCAGGTGGAGGAGGGGAGG - Intergenic
1152348563 17:79769958-79769980 TCAGACAGGAGCTGGCGCTGCGG - Intergenic
1152408964 17:80112456-80112478 TGAGGCAGAGGCTGGGGAGGAGG - Intergenic
1152540458 17:80971923-80971945 GCTGGCAGGAGCTGGGGGCTGGG + Intergenic
1152667544 17:81580064-81580086 GGAGGCAGGAGCTGGGGAGGAGG - Intronic
1152728654 17:81959682-81959704 TCAGGTAGTAGCTGCGGGGGAGG + Exonic
1152929911 17:83104186-83104208 GCAGGCAGGAAGTGGAGGGGAGG - Intergenic
1153294184 18:3530116-3530138 CCAGCCAGGAGCTGGGTGGGTGG + Intronic
1153334409 18:3907539-3907561 TCAGGCTGGAGCTGATGTGGAGG + Intronic
1153605470 18:6827642-6827664 CCAGGAGGGAGGTGGGGGGGGGG - Intronic
1153778752 18:8476399-8476421 GCAGGCAGGAGTGGGGGTGGGGG + Intergenic
1153805287 18:8705250-8705272 TCAGCCGGGAGCGGCGGGGGCGG + Intergenic
1154123461 18:11670088-11670110 ACAGGCTGGGGCTGGGGGAGAGG - Intergenic
1155077044 18:22367802-22367824 TGTGGCGGGAGCTGGGGGGGAGG + Intergenic
1155510293 18:26569566-26569588 TCAGGCAGGTGGGGGGTGGGGGG + Intronic
1156023057 18:32621313-32621335 GCAGGCAGAAGCCGAGGGGGAGG + Intergenic
1156453380 18:37279226-37279248 TCAGGCAGGTGCTGCTGGGCTGG + Intronic
1156472794 18:37388044-37388066 GAAGGCAGGAGTTGGGGGAGGGG + Intronic
1156489404 18:37487387-37487409 TGAGGCAGGAGTTGGAGGTGGGG - Intronic
1156496788 18:37531028-37531050 TGAGGCAGGAGCTGGGGTGGGGG + Intronic
1156502616 18:37569023-37569045 TGGGGCAGGAGCTGGGAGGGAGG - Intergenic
1157257696 18:46153249-46153271 TGAGGAAGGGGCTGGGGGAGGGG + Intergenic
1157478362 18:48037381-48037403 TCAGGAATGTGCTGGGAGGGAGG + Intronic
1157591812 18:48840830-48840852 TGTGGCAGGAGCTGGGTTGGAGG - Intronic
1157891960 18:51426517-51426539 TCATGCAAGAGATGGGGGGTGGG - Intergenic
1159001549 18:62979351-62979373 TGCGGCTGGAGCTGAGGGGGTGG - Exonic
1160009777 18:75097840-75097862 TAAAGCAGGAGCTGGGAAGGGGG + Intergenic
1160042791 18:75360791-75360813 TCAGGCGGTGGCTGGGGTGGAGG + Intergenic
1160412954 18:78687519-78687541 TCAGGCAGGGGCTGGCGGCAGGG - Intergenic
1160563872 18:79775011-79775033 TCAGGCAGGAGTGGGAGGGTGGG + Intergenic
1160666046 19:329154-329176 CTGGGCAGGAGCTGGGGTGGAGG - Intronic
1160757904 19:767290-767312 TCAGTCAAGAGCGGGGTGGGGGG + Intergenic
1160826280 19:1082008-1082030 CCAGGCAGGAGGAGGCGGGGTGG + Intronic
1160860847 19:1236786-1236808 GCAGGCCGCGGCTGGGGGGGCGG + Intronic
1160861833 19:1240405-1240427 CCAGGCAGGAGGTGGGGGGTCGG + Intergenic
1160865153 19:1253017-1253039 TCAGGAAGGAGCTGGGTTGGGGG + Intronic
1160895161 19:1399051-1399073 TCAGGACGGAGGTGGGGGTGTGG + Intronic
1160909694 19:1468914-1468936 TCTGGGAGGAGCTGGAGGAGGGG - Exonic
1160941338 19:1621768-1621790 CCAGGCAGGGTCTGGGTGGGGGG - Intronic
1160944585 19:1635496-1635518 TCAGGCAGGGGGTGTGGGTGGGG - Intronic
1161101609 19:2424537-2424559 TTAGCCTGGAGCTGGAGGGGGGG - Intronic
1161267432 19:3370837-3370859 ACAGGCAGGAGAGTGGGGGGCGG - Intronic
1161393562 19:4033336-4033358 ACAGGATGGAGCTGGGGGTGAGG + Intronic
1161751664 19:6102140-6102162 GCAGGCAGCAGATGGGGGAGAGG - Intronic
1161767608 19:6216071-6216093 CCAGGCTGGAGGTGGGGGGAGGG - Intronic
1161864351 19:6822522-6822544 CCCGGCAGGCGCTGGGTGGGAGG - Intronic
1162052673 19:8044203-8044225 TGGGGCAGGAGGTGCGGGGGTGG - Intronic
1162135806 19:8554630-8554652 TGAGGCTGGGGCTGGGTGGGAGG - Intronic
1162405162 19:10468807-10468829 TCAGGGACTAGCTGGGGGAGAGG - Exonic
1162496280 19:11024989-11025011 TGAGGAAGGAGGTGGGGGCGGGG - Intronic
1162582555 19:11539866-11539888 TGGGGCCGGCGCTGGGGGGGAGG - Intronic
1162727813 19:12700622-12700644 TCAGGCGGGATCTCGGGGCGGGG - Exonic
1162794411 19:13079109-13079131 TCAGCCAGGAGCTGGGAGAGAGG - Intronic
1162914436 19:13866259-13866281 GCAGGCTGGGGGTGGGGGGGTGG + Intronic
1163159668 19:15457213-15457235 TCGGGCAGGAGTTGGGGCGCAGG - Intronic
1163262488 19:16199600-16199622 TCAGGAAAGTGCTGGGGGTGGGG - Intronic
1163265011 19:16215189-16215211 TAAGGCGGGGGCGGGGGGGGGGG + Intronic
1163441231 19:17323647-17323669 CCCGGCAGGGGCTGGGGGGCGGG + Exonic
1163443592 19:17333992-17334014 TAAGGGAGGATCTGGGGGGAAGG - Intronic
1163458154 19:17420675-17420697 GCAGGGAGGAGCGGGGGAGGAGG + Intronic
1163511579 19:17738742-17738764 TCAAGCTGGAGCTTGGGGGCAGG - Intergenic
1163607816 19:18284920-18284942 TGAGGCAGGAGGTGAGTGGGCGG + Intergenic
1163634242 19:18431026-18431048 GCAGGCTGGAGTTGGGTGGGAGG + Intronic
1163673955 19:18646016-18646038 CCTAGCAGGAGCTGGGGGGCTGG - Intronic
1163905931 19:20150148-20150170 CCGGGAAGGAGGTGGGGGGGGGG - Intergenic
1164627841 19:29741228-29741250 TGAGACAGGAGCTGGGGGAGTGG - Intergenic
1164986298 19:32651281-32651303 TCATGCTGCAGCTGGAGGGGGGG - Intronic
1165067266 19:33236562-33236584 CCAGGCCCGAGCTGGGGTGGAGG - Intergenic
1165139785 19:33691815-33691837 ACAGGCAGGTGTTGGGGTGGAGG + Intronic
1165230198 19:34381939-34381961 TGCAGGAGGAGCTGGGGGGGTGG + Intronic
1165232013 19:34393183-34393205 TCCGGCAGGAGGTGGGGGGCGGG + Intronic
1165247234 19:34504738-34504760 TCAGGGTGGGGCTGGGTGGGAGG - Exonic
1165361061 19:35337358-35337380 TGAGGCAGCAGCTGGGTGGGAGG + Intronic
1165891764 19:39116847-39116869 TCATCCAGGTGCTGGGAGGGTGG - Intergenic
1165899542 19:39162597-39162619 TCAGAAAGGAGCTGAGGGGAGGG - Intronic
1166360399 19:42250744-42250766 CTAGACAGGAGCTGGGGGGGAGG + Intronic
1166551376 19:43668395-43668417 TCGGGGAGGAGCTAGGGGGCGGG - Intronic
1166668193 19:44694196-44694218 TCTGGAAGGTGCTGGAGGGGAGG - Intergenic
1166674685 19:44732713-44732735 CCAGGCAGGAGGAGGTGGGGAGG + Intergenic
1166677218 19:44747603-44747625 TCAGGCTGGAGATGGGAGGGAGG - Intergenic
1166750236 19:45161059-45161081 ACAGGCAGGCGCTGGGGAAGGGG - Intronic
1166761651 19:45228018-45228040 TCAGCCAGGAGTTTGGGGAGCGG - Exonic
1166785514 19:45364537-45364559 GCATGCAGGATCTGGGGGGCCGG + Exonic
1166818000 19:45558372-45558394 TGCGGCAGGAGTTGGGGGTGGGG - Intronic
1166985659 19:46659038-46659060 CCTGGCAGGGGCTGGGGGTGGGG + Intronic
1167040638 19:47020898-47020920 CCAGCAAGGAGCTGGGGGGGGGG - Intronic
1167115919 19:47489042-47489064 TCAGCCAGGAGCTCAGGGAGGGG - Intronic
1167578670 19:50329624-50329646 CTAGGCAGGACCTGGTGGGGAGG + Intronic
1168072121 19:53959147-53959169 AAACGCAGGGGCTGGGGGGGAGG - Intergenic
1168153795 19:54462467-54462489 ACTGGCAGGCGCTGGGGAGGAGG - Exonic
1168254059 19:55156554-55156576 GCAGGCAGGTGCTCAGGGGGCGG - Intronic
1168266226 19:55225216-55225238 TGAGGGAGGAGCTGGGGGCCTGG - Intergenic
1168401086 19:56086779-56086801 CCAGCCAGGGGCTGGGGGAGAGG - Intergenic
1168695953 19:58404868-58404890 CCAGGAGGGAGGTGGGGGGGGGG - Intronic
925374752 2:3376233-3376255 ACAGCCATGAGGTGGGGGGGAGG + Intronic
925409745 2:3633134-3633156 CCAGGGAGGAGCTGTGTGGGTGG - Intronic
925415613 2:3668216-3668238 TCAGGCAAAAGCTTGGAGGGAGG + Intronic
925428309 2:3769594-3769616 TCCAGCAGAAGCTGTGGGGGAGG - Intronic
925714250 2:6770349-6770371 TGAGGCAGGGGCTGAGGAGGTGG - Intergenic
925920983 2:8637655-8637677 GCAGGGAGGATCTGGGCGGGAGG - Intergenic
925959460 2:9002610-9002632 TGAGGCGGGGGCTGGGGGGCGGG - Intronic
925980022 2:9169142-9169164 TAAGGCAGCAGCTGGGGAGGAGG + Intergenic
925992628 2:9266015-9266037 CAAGGCAGGGGGTGGGGGGGTGG - Intronic
926077019 2:9950631-9950653 GCAGGCAGGCCCTGGGGAGGCGG - Intergenic
926130530 2:10301276-10301298 ACAGGCAGGAGGTGGGGTTGGGG - Intergenic
926364004 2:12116308-12116330 TGATGCAGAAGCTGGGGGTGAGG - Intergenic
926419795 2:12685444-12685466 TCCCCCAGGAGCTGGGGGAGAGG + Intergenic
927000950 2:18793753-18793775 TCAGGGTGGAGCTGAGGGAGAGG - Intergenic
927267166 2:21163390-21163412 TCAGGCAGGAGGTGGGGCTGGGG - Intergenic
927515798 2:23671000-23671022 GAAGGGAGGAGGTGGGGGGGGGG - Intronic
927692709 2:25219600-25219622 ACAGGCAGGAGCTGGAGGCCAGG - Intergenic
927709283 2:25314947-25314969 TCAGGCCACAGCTGGGGTGGGGG + Intronic
927937273 2:27082938-27082960 TGAGCGGGGAGCTGGGGGGGCGG + Exonic
927988122 2:27428245-27428267 GCAGGCGGGGGCTGGGGTGGGGG + Intronic
928115478 2:28542782-28542804 ACAGGCAGGAGCCTGGAGGGAGG - Intronic
928368872 2:30724424-30724446 TCCGAGAGGAGCTGGAGGGGTGG - Intronic
928371116 2:30740895-30740917 TCAGGCATCAGCTCTGGGGGAGG + Intronic
929216199 2:39416159-39416181 TCAGTCAGATGCTGGGAGGGTGG + Intronic
929454853 2:42058314-42058336 TGAGCCAGGACCTGGGGCGGGGG + Exonic
929776298 2:44933054-44933076 TGAGGTAGGAGCTGGAGGAGGGG - Intergenic
930063242 2:47308461-47308483 TGAGTCAGGAGCTGGTGGAGGGG - Intergenic
931880879 2:66569392-66569414 GCAGTCAGGAGGTGGGGGAGTGG + Intronic
932131280 2:69189616-69189638 CCAGGCAGGAGCTGTGGAGGTGG + Intronic
932471724 2:71963525-71963547 TAAGGCAGGAGCTGGAGCTGTGG - Intergenic
932564187 2:72895232-72895254 TCAGTGAGGAGCTGGGGGAAAGG + Intergenic
932577025 2:72968353-72968375 CCAGGCAAGAGATGAGGGGGTGG - Intronic
932887275 2:75559685-75559707 TGAGAAAGGAGGTGGGGGGGGGG + Intronic
933536702 2:83584580-83584602 GCAGGCAGCAGGTGGTGGGGTGG - Intergenic
933720537 2:85394842-85394864 GCAGGCAGGTGGTGGGGGGCAGG + Exonic
933776642 2:85774941-85774963 TGAGGAAGGAGCTGGGGTTGGGG - Intronic
933973514 2:87489459-87489481 AGAGGCAGGAGCTGGGGCTGGGG + Intergenic
934647528 2:96067912-96067934 GGAGGCAGGAGCTGTGGGAGTGG + Intergenic
934652770 2:96101812-96101834 GCAGCCAAGAGCTGGTGGGGGGG + Intergenic
934691656 2:96365396-96365418 TCGGGCAGGGGGTGGGGTGGGGG - Intronic
934718235 2:96555328-96555350 TCAGGCAAGAAGTGGGGAGGAGG + Intergenic
935218887 2:100995235-100995257 TCTGGCAAGACCTGGGGGTGTGG - Intronic
935223542 2:101034998-101035020 TCGGGCAGGAGGTTGGGGGCTGG + Intronic
935237927 2:101153390-101153412 ACAGGCAGGAGCTTCGGAGGTGG - Intronic
935268199 2:101412241-101412263 TCAGGGAGGACCTGGGAGGCAGG - Intronic
935452090 2:103221779-103221801 GCAGGCAGGAGTTGGGGCAGAGG - Intergenic
936086595 2:109473723-109473745 GCAGGCAGGAGTGGGTGGGGTGG - Intronic
936320211 2:111460754-111460776 AGAGGCAGGAGCTGGGGCTGGGG - Intergenic
936343841 2:111660194-111660216 TCAGGGAGAAGCTGGTGAGGAGG - Intergenic
936729356 2:115361435-115361457 TCAGGCAGGGGCTTTGAGGGTGG + Intronic
936912731 2:117609539-117609561 TGAGGCAGGAGGTGGGAGGGTGG + Intergenic
937030694 2:118737348-118737370 TCAGGCAGGAGTGGGGCGTGGGG + Intergenic
937986161 2:127639057-127639079 GGAGGCAGGAGCTGGGGAGTGGG - Exonic
937987696 2:127645899-127645921 GCAGGCGGGGGCTGGGTGGGGGG - Exonic
938442846 2:131351980-131352002 TTATCCAGGAGCTGGTGGGGAGG - Intronic
938603889 2:132872552-132872574 TCAGCCAAGGGCTGGGGTGGAGG + Intronic
939497282 2:142939059-142939081 TGAGGCAGGAGCTCAGGAGGTGG + Intronic
939731363 2:145788322-145788344 TCTGTCATGAGATGGGGGGGTGG + Intergenic
940895918 2:159081804-159081826 CCAGGGAGGAGCTGGGGGAAGGG - Intronic
941448990 2:165635973-165635995 TGAAGCAGAAGCTGGTGGGGAGG - Intronic
941850763 2:170177643-170177665 GGAGGCAGGGGGTGGGGGGGTGG - Intergenic
942068838 2:172297301-172297323 TCATGAAGGATCTGGGGTGGGGG - Intergenic
942227306 2:173828751-173828773 AGAGGAAGGAGCTGGGGCGGGGG - Intergenic
942965814 2:181891762-181891784 TCAGGCAGGGGGTGGGGAGCAGG + Intergenic
943449839 2:188033707-188033729 GCGGGCAGGGGTTGGGGGGGGGG - Intergenic
943561364 2:189467094-189467116 TCAGGCATCAACTGGGGCGGGGG - Intronic
943639161 2:190340550-190340572 GCAAGAAGGAGTTGGGGGGGAGG - Intronic
944156286 2:196610952-196610974 TCATGCAGAGGGTGGGGGGGTGG - Intergenic
944667592 2:201970226-201970248 TCATCCTGGAGCTGTGGGGGTGG - Intergenic
944876973 2:203972192-203972214 TAATGCAGGTGCTGGGGTGGAGG + Intergenic
945039748 2:205733813-205733835 TCAGGGAGGAGCGGGGAGGAGGG - Intronic
946053516 2:216882678-216882700 TAAAGCAGGACCTGGGGTGGGGG + Intergenic
946178041 2:217933792-217933814 ACGGGCAGAAGCTGGGTGGGAGG + Intronic
946247168 2:218394466-218394488 GGAGGCAGGAGGTGGGGAGGGGG + Intronic
946656915 2:221958326-221958348 TTGGGCAGCAGCTGGTGGGGAGG - Intergenic
947032187 2:225809184-225809206 TAATGCAGGGGCTGAGGGGGTGG + Intergenic
947378742 2:229524517-229524539 TCATGCAGGAACTGGGAAGGAGG - Intronic
947949262 2:234133760-234133782 TCAGACAGCACCCGGGGGGGTGG + Intergenic
948064878 2:235070142-235070164 TCAGGCAGGAGGAAGGGGAGGGG + Intergenic
948174953 2:235935981-235936003 CCAGGCAGGAGCCAGCGGGGAGG - Intronic
948504493 2:238419063-238419085 TCAGCCAGGGGTTGGGGGAGGGG - Intergenic
948580918 2:238986679-238986701 TCAGGCAGGGTCTGGGGGCTCGG + Intergenic
948669849 2:239561298-239561320 TCAGAAAGGAGGTGGGTGGGAGG - Intergenic
948726002 2:239934364-239934386 TCAGGCTGGGGGTGGGGGTGGGG - Intronic
948805328 2:240451456-240451478 TCAGGCAGGCTGTGGGAGGGTGG - Intronic
1168838820 20:895545-895567 ACAGGCAGGGGCTGGGGGAGAGG + Intronic
1169130855 20:3165839-3165861 TCATCCAGGAGCTGGAGGAGCGG - Exonic
1169209908 20:3760111-3760133 TCTGGCAGGAGCTGCGTGGCAGG - Exonic
1169673553 20:8131286-8131308 ACACGCGGGAGGTGGGGGGGCGG - Intergenic
1170210732 20:13844104-13844126 TCAGCCAGGAGCTGAGGCAGAGG + Intergenic
1170567512 20:17615408-17615430 GCAGGCAGGGGCTGGGGCGGGGG - Intronic
1170732108 20:18984720-18984742 GCAGGCAGGAGCTGCGGGCACGG + Intergenic
1171174174 20:23038846-23038868 TCATGCAGGTGGTGGCGGGGTGG + Intergenic
1172044561 20:32071256-32071278 TCAGTGAGGTGCTGGTGGGGTGG + Intronic
1172183631 20:33018521-33018543 TCTTGCAGGGGCTGGGGGGCAGG + Intronic
1172205263 20:33158855-33158877 GCAGGCAGGAGCTGCAGGAGGGG - Intergenic
1172273657 20:33668237-33668259 TCAGGCTGGACTGGGGGGGGTGG + Exonic
1172309700 20:33908176-33908198 TCCTGCAGGAGCTGGGGGCAGGG + Intergenic
1172782186 20:37443469-37443491 TGAGGCAGGGGCTGAGGGGATGG - Intergenic
1172887233 20:38239493-38239515 TCAAGCAGGAGGTGGTAGGGAGG - Intronic
1173006484 20:39143224-39143246 TCAGCCAGGGGCTGGGTGGGAGG + Intergenic
1173472605 20:43335415-43335437 TAGGGCAGGAGCTGGGGAGGTGG + Intergenic
1174051335 20:47769575-47769597 TCTGCCAGGAGCTGGGGCCGTGG - Intronic
1174101179 20:48127326-48127348 GCAGGCTGGAGCTGAGCGGGTGG - Intergenic
1174129402 20:48331717-48331739 ACAGCTAGGAGGTGGGGGGGTGG - Intergenic
1175530401 20:59671025-59671047 CCAGGGAGGAGCTGTGGAGGGGG - Intronic
1175547112 20:59785491-59785513 ACTGGCAGGAGCTGGGGAGTGGG + Intronic
1175550636 20:59814938-59814960 TCAAACAGGAGGTGGGGGGAGGG + Intronic
1175839034 20:62015051-62015073 ACAGGCAGGAGGTGGGGGCAAGG - Intronic
1175889975 20:62311710-62311732 TGCGGCTGGAGCTCGGGGGGTGG + Exonic
1175939008 20:62529283-62529305 GCTGCCAGGAGCTGGGAGGGAGG + Intergenic
1176093089 20:63327547-63327569 TCACCAAGGAGCTGGGGAGGTGG + Intronic
1176146150 20:63566421-63566443 TGAGGCAGGAGCTGAGGAGGCGG - Exonic
1176244723 20:64091954-64091976 GCAGCCCGAAGCTGGGGGGGAGG - Exonic
1177932012 21:27296892-27296914 TCAGGCAAGAGCTTGGGCAGGGG - Intergenic
1178281318 21:31285252-31285274 TCAGGGAAGAGCTTGTGGGGGGG + Intronic
1178375105 21:32060182-32060204 ACAGGCAGGTGCTGTGGTGGGGG + Intergenic
1178419949 21:32435392-32435414 TGAGGCAGGAACTGTGGGGCAGG - Intronic
1179531802 21:42024603-42024625 ACAGGCAGGACCCGGGGAGGAGG - Intergenic
1179552185 21:42150504-42150526 TCCGCCAGGAGCTGGGGCAGAGG + Intergenic
1179558141 21:42193797-42193819 TAAGGCAGGAGCTTGGGGTGTGG - Intergenic
1179573345 21:42291394-42291416 TCTGGCGGGAGCTGCGGGGAAGG + Intronic
1179942158 21:44647292-44647314 CCAGGCGGGAGCTTGCGGGGCGG - Exonic
1179983776 21:44910238-44910260 TCACCCAGGAGCTGGGCAGGTGG + Intronic
1180021451 21:45130678-45130700 TAAGGCAGGACCCGGGAGGGAGG - Intronic
1180081534 21:45489865-45489887 TCGGGGAGGAGGTGTGGGGGAGG - Intronic
1180093256 21:45543018-45543040 TCAGGCAGGAGGGCGGGCGGCGG - Intronic
1180605723 22:17057637-17057659 TAAGGCAGGAGCAGTGGGAGTGG - Intergenic
1180657670 22:17436882-17436904 TTAGGCAGGAACTGGGGGTGGGG + Intronic
1180992284 22:19943886-19943908 GCATGCAGGAGCTGGAGGGGGGG + Intronic
1181042276 22:20197804-20197826 GCAGCCAGGAGCTGGGCAGGGGG - Intergenic
1181111593 22:20605851-20605873 TCAAGCAGGAGATGAGGGGAAGG + Intergenic
1181280588 22:21717125-21717147 GGAGGCCGGGGCTGGGGGGGCGG + Intronic
1181526724 22:23493744-23493766 TCACCCAGGAGCTGAGCGGGAGG + Intergenic
1182070834 22:27462551-27462573 GCAGGCAGGAGCTGGGGAGGAGG + Intergenic
1182095268 22:27621553-27621575 TCAGGCAGGGCCTGGGGAAGGGG - Intergenic
1182610075 22:31540178-31540200 TCTGGCACGGGGTGGGGGGGTGG + Intronic
1183015945 22:34986785-34986807 TGAGCCAGCAGCTGTGGGGGAGG + Intergenic
1183094282 22:35542774-35542796 TCAGGCAGGCCCTGGGAGAGAGG + Intronic
1183172575 22:36198917-36198939 TCAGCCAGGAGCAGAGAGGGAGG + Intronic
1183186400 22:36293899-36293921 TGGGGCAGGAGCAGTGGGGGTGG - Intronic
1183197666 22:36364588-36364610 TGAGGCAGGGGGTGGGGCGGAGG - Intronic
1183201019 22:36386261-36386283 TCTGCCAGGTGGTGGGGGGGTGG - Intronic
1183321210 22:37166266-37166288 CTCGGCAGGAGGTGGGGGGGCGG - Intronic
1183342183 22:37287551-37287573 TCCGGCAGGAGCTGGCGGGGAGG - Intronic
1183586254 22:38755007-38755029 TTAGGGAGGAGGTGGGGCGGGGG - Intronic
1183664853 22:39241403-39241425 TCAGGCTGGCCCTGGGGGAGGGG - Intronic
1183667277 22:39253243-39253265 ACAGGAAGGAGCTGGGGAGGGGG - Intergenic
1183781867 22:40003927-40003949 TGAGTCAGGAGATGGGGGTGCGG + Intronic
1184027281 22:41867139-41867161 TGAGGCTGGGGCTGGGGGCGGGG - Exonic
1184103767 22:42355569-42355591 TCAGGCAGGGGCATGGGGTGGGG - Intergenic
1184215763 22:43066281-43066303 TCAGGAAGGAAATGGGGGTGGGG + Intronic
1184289211 22:43489384-43489406 GCAGGCAGGAGCAGGTGGGTGGG - Intronic
1184331982 22:43833202-43833224 GAAAGCAGGAGCTGGGGGAGGGG - Intronic
1184352266 22:43952140-43952162 ACAGGAAGGTGCTGGGGGTGTGG - Intronic
1184601568 22:45546883-45546905 GCAGGCAGGAGCAGGGATGGAGG + Intronic
1184640189 22:45866525-45866547 GCAGGCGGGTGCTGGGGAGGTGG + Intergenic
1184676410 22:46045534-46045556 TCAGGATGGTGCTGGGGGTGTGG - Intergenic
1184686451 22:46098509-46098531 TCAGGCATCACCTGGGGAGGTGG - Exonic
1184950570 22:47839785-47839807 AGAGGCAGGAGCGGAGGGGGAGG - Intergenic
1184962354 22:47940698-47940720 TCAGGAAGGAGCTGTGGGGACGG - Intergenic
1184975317 22:48057631-48057653 TCCGGCAGGAGATGGAGGAGAGG + Intergenic
1185014024 22:48333173-48333195 TCAGGCCAGCGCTGGGGGGCAGG - Intergenic
1185157034 22:49199294-49199316 ACAGGAAGTAGCTGGGGAGGGGG - Intergenic
1185164920 22:49255546-49255568 TCAGGCAGGAGCGGGTGGCGGGG - Intergenic
1185265540 22:49900712-49900734 TCAGGGTGGAGATGGGGGGTGGG + Exonic
1185272664 22:49935996-49936018 TCCGGGAGGAGCAGGGGTGGAGG + Intergenic
1185320202 22:50197203-50197225 GCAGGCATCAGCTGGAGGGGCGG - Intronic
1185383617 22:50521659-50521681 TGGGGCATGAGGTGGGGGGGTGG + Intronic
1185422925 22:50744996-50745018 TGAGGCTGGAGGTGGGGGTGGGG - Exonic
950363840 3:12469112-12469134 TCAGGCAGGAGCTCAGGGCCTGG - Intergenic
950430786 3:12949751-12949773 CCAGGCAGGGTCTGGGGGGCGGG + Intronic
950443216 3:13021934-13021956 CCAGGAAGGAGCTGGGATGGAGG - Intronic
950527981 3:13535839-13535861 TCAGGCAGGAGCCTTGGGGGTGG + Intergenic
950563365 3:13748939-13748961 CCAGGCAGGGGCTGGGGGCTTGG - Intergenic
950614997 3:14151061-14151083 TGAGGCAGGAGCTGGGGTGGTGG + Intronic
950962274 3:17119071-17119093 CCAGGCAGGGCCTGGGGGGTAGG + Intergenic
951106614 3:18751449-18751471 TGAAGCAGGAGATGGGGTGGAGG - Intergenic
951162427 3:19441029-19441051 GCAGGCAGGAGGAGGGGAGGAGG + Intronic
951253304 3:20419132-20419154 TCAGGCAGTTGCAGGGGGGAAGG + Intergenic
952622912 3:35367789-35367811 CCAGGCAGGAGCTCTGGGAGGGG - Intergenic
952816793 3:37453121-37453143 TCTTGTAGGAGCTGGGGGGGGGG - Intronic
953332417 3:42064953-42064975 TCAGGCAGGAGAATGGCGGGAGG + Intronic
953535573 3:43774431-43774453 TCAGGCAGGGGCTCTGGTGGGGG + Intergenic
953752940 3:45623340-45623362 TCATGTAGGAGTTGGGGGTGGGG + Intronic
953899419 3:46831179-46831201 TCTGGCAGGACTTGGGAGGGAGG - Intronic
953925590 3:46980838-46980860 CCAGGCAGGTGCAGGGAGGGAGG - Intronic
954080678 3:48211424-48211446 CCAGGAGGGAGGTGGGGGGGGGG + Intergenic
954091716 3:48289593-48289615 TCAGGCGGGAGCTGTAAGGGAGG - Intronic
954264343 3:49461230-49461252 TCAAGCAGTAGCTCTGGGGGAGG + Intergenic
954540431 3:51390190-51390212 TCAGGCAGGTGCAGGGGGAAAGG - Intergenic
954614816 3:51964184-51964206 TCAGGCTGGAGGAGGCGGGGGGG + Intronic
954669102 3:52278634-52278656 ACAGGCAGAAGCTGAGGGCGAGG + Exonic
954681848 3:52350177-52350199 GCAGGCAGGGGCTGGGAGGTCGG + Intronic
955204742 3:56885651-56885673 TCTGGCAGGAACTGGGTTGGGGG - Intronic
955712778 3:61797589-61797611 GAAGGCGGGAGGTGGGGGGGTGG - Intronic
956097645 3:65734220-65734242 TGAGGCAGGAGGTGGGAGGAAGG + Intronic
956302570 3:67788531-67788553 TGAGGGAGGTGCTGGGTGGGAGG + Intergenic
956466394 3:69524556-69524578 TCTGGCAGCAGCTGGGGGCTGGG + Intronic
956791490 3:72683500-72683522 TCTGGCAGGGGGTGGGGGTGGGG + Intergenic
958088385 3:88843153-88843175 TCAGGCAGTAGCTGGAAGAGTGG + Intergenic
958603610 3:96330754-96330776 ACAGGAAGGTGCTGGAGGGGTGG - Intergenic
959586999 3:108034174-108034196 TGAGGCAGGAGCTGGGGTGCTGG + Intergenic
960034191 3:113086527-113086549 TCCAGCAGGAGCTGGGGGCAGGG + Intergenic
960708482 3:120504472-120504494 GCTGGCAGGAGCTGGGAAGGTGG + Intergenic
960950121 3:122993771-122993793 GGAGGCAGGAGCGGGAGGGGTGG - Intronic
961359804 3:126360118-126360140 GCAGGCATGAGCTAGTGGGGAGG - Intergenic
961392938 3:126567173-126567195 TTTGTCAGGAGCTGGGGAGGTGG + Intergenic
961731697 3:128969814-128969836 TCAGGCTGGAGCGTGGGGTGGGG + Exonic
961812246 3:129528580-129528602 TCAGCCAGGAGCTTAGGAGGGGG + Intergenic
962003589 3:131326359-131326381 TCAGGCAGGAGCAGGGAGCCTGG - Intronic
962204333 3:133422750-133422772 TCTGGCAGGTGCTGGGCTGGGGG - Intronic
962581237 3:136799782-136799804 TCAGGCAGGAGCAGAGGGGATGG + Intergenic
964455681 3:156863106-156863128 TAAGGCAGGGGTTGGGGAGGTGG + Intronic
964476203 3:157100130-157100152 TCTGCCAGGAGCTGGGGGTTAGG + Intergenic
965390323 3:168095875-168095897 TTGGGCAGGAGGTGGCGGGGCGG - Exonic
965516614 3:169628755-169628777 TCAAGAAGGAGCTCAGGGGGAGG + Intronic
966608948 3:181849257-181849279 TGAGGCAGGAGATCGGGAGGCGG + Intergenic
966787942 3:183636877-183636899 TCAGGCAGCAGCAGCGGCGGCGG - Intronic
967253543 3:187567064-187567086 CCAGCCAGGACCTGGGGAGGTGG + Intergenic
967709385 3:192687689-192687711 GGAGGCAGGAGCTGGGGGGTGGG - Intronic
968079703 3:195837351-195837373 TCAGGGATGATCTGGGAGGGAGG + Intergenic
968222413 3:196948549-196948571 TCTGGGAGGAGCTGGGGCCGTGG - Exonic
968548348 4:1210027-1210049 TCCAGCTGGAGCTGGGAGGGCGG + Intergenic
968568304 4:1326619-1326641 TGAGGCAGGGGCGGGGGTGGGGG - Intronic
968577983 4:1376802-1376824 TGCGGCAGGAGCTGAGGCGGCGG - Intronic
968596670 4:1489523-1489545 TCAAGCAGGAGCGGGGGCAGTGG + Intergenic
968605324 4:1532591-1532613 GCAGGCTGGACCTGGGTGGGTGG - Intergenic
968615004 4:1573763-1573785 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615013 4:1573797-1573819 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615018 4:1573815-1573837 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615027 4:1573849-1573871 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615036 4:1573883-1573905 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615041 4:1573901-1573923 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615050 4:1573935-1573957 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968616712 4:1580726-1580748 GGAGGCAGGACCTGGGAGGGAGG - Intergenic
968886887 4:3339720-3339742 CCAGGCTGGAGGTGGGCGGGCGG + Intronic
969238954 4:5887441-5887463 CCAGGCAGGAACTGGGGCGGAGG + Intronic
969563253 4:7962748-7962770 TCAGGGAGTTGATGGGGGGGTGG - Intergenic
969643099 4:8411025-8411047 ACAGGCAGGAGCTGGGCCGCTGG + Intronic
971349845 4:25845975-25845997 TTAGTCAGGATCTGCGGGGGTGG - Intronic
972602767 4:40587322-40587344 TCAGGGAGGAACTGTGGGGCAGG + Intronic
973283503 4:48388647-48388669 TCAGGGAGGAGCTGGGAAGAGGG - Intronic
974061053 4:57036292-57036314 TCAGGCAGGAGGAGGAGGTGGGG + Intronic
974345193 4:60670010-60670032 TCAGGGTGGAGCTGTGGGGTGGG - Intergenic
975292185 4:72689673-72689695 TCAGGCACTAGGTGGGGGAGTGG - Intergenic
975747812 4:77492064-77492086 TCAGGCAGGAGCCAGGAGAGAGG + Intergenic
976264269 4:83175310-83175332 TCAGGCAGGTGGTGGTTGGGTGG - Intergenic
976387689 4:84480284-84480306 TGAGGAAGGAGGTGGGGGAGTGG + Intergenic
976388573 4:84486027-84486049 GAAGGCAGGAGATGGGGGAGTGG - Intergenic
978392951 4:108246670-108246692 AGAGGCAGGAGTTGGGGGTGGGG - Intergenic
979231663 4:118353711-118353733 CGAGGCAGGTGCTAGGGGGGTGG - Intergenic
980275045 4:130640018-130640040 CCAGGCAGGTTGTGGGGGGGAGG - Intergenic
980908831 4:138975706-138975728 TGAGGTAGGGGCGGGGGGGGGGG - Intergenic
981823749 4:148915636-148915658 TCCTGCAGGATCTGGGGGAGTGG - Intergenic
982125298 4:152178822-152178844 TCAGGAAGGAGCTGGTTGGCTGG + Intergenic
982678922 4:158407107-158407129 TCAGGCAAGAGCTGATGGAGAGG + Intronic
982897124 4:160945499-160945521 CAAGGCAGGAGCTGGGGGGAAGG + Intergenic
983631289 4:169852296-169852318 TCAGGCTGGAGCTGGGAGTGTGG + Intergenic
984951198 4:185009095-185009117 GCAGGCAGGGATTGGGGGGGTGG - Intergenic
985564801 5:610153-610175 TCAGGCAGGTGCTCTGTGGGAGG - Intergenic
985675588 5:1229849-1229871 ACAGGCTGGAGATGGGGGAGGGG + Intronic
985893794 5:2737615-2737637 ACAGGCAGGAGATGGGGCTGGGG - Intergenic
985922782 5:2992625-2992647 TCAGGCAGGAGTTGGTGCTGGGG - Intergenic
986052806 5:4105549-4105571 CCAGGCAGGAGCAGTGGGGCAGG + Intergenic
986516995 5:8574594-8574616 TCAGGGAGGAGGGGTGGGGGAGG + Intergenic
986543331 5:8870116-8870138 GCAGGCAGGAGCAGAGGGTGTGG + Intergenic
987053802 5:14171767-14171789 GCAGGAAGGAGCGGGGTGGGGGG + Intronic
987212256 5:15694757-15694779 TAAGGCAGGAGCTGGGGAGGAGG + Intronic
988012903 5:25513548-25513570 TCAGTTAGCAGCTGGGGTGGTGG + Intergenic
988242528 5:28632515-28632537 TCAGACAGGAGCCGGGCAGGAGG + Intergenic
988449260 5:31323536-31323558 ACAGGCAGGTGCCGGAGGGGAGG + Exonic
988460182 5:31428270-31428292 ACAGGGAGGAGGTGGGGGTGGGG + Intronic
989152237 5:38311349-38311371 CCAGGCAGGGGCTGGGGGACTGG - Intronic
989786351 5:45336156-45336178 TCAGGCAGCAACTGAGAGGGAGG + Intronic
991111661 5:62906752-62906774 TCAGTCAGGAGCTGAAGTGGAGG + Intergenic
991245133 5:64502580-64502602 TCTTGCAGGAGCTGGGGGGCAGG - Intergenic
992116547 5:73543807-73543829 ACTGGCAGGAGCTGGGGGTTGGG + Intergenic
992225320 5:74614718-74614740 TAAGTCAGGACCTGGGGCGGGGG + Intergenic
992582625 5:78196849-78196871 ACTGCCAGGAGCTGGTGGGGAGG + Intronic
992614429 5:78535275-78535297 TCAGGGAGGAGGTGGGTGGAAGG - Intronic
992964016 5:81983237-81983259 CCAGGAGGGAGGTGGGGGGGGGG - Intronic
993504038 5:88690493-88690515 TAACGCGGGAGCTAGGGGGGTGG - Intergenic
995030281 5:107472992-107473014 TCAAGCAGGTGCTGGGGGGAGGG - Intronic
995068154 5:107885821-107885843 GCAGGCACGAGATGTGGGGGTGG + Intronic
995546151 5:113233655-113233677 TCTGGCTGGAGTTGGGGTGGAGG - Intronic
995824656 5:116282150-116282172 TCTGGCAGAAGCTGGAGGGATGG - Intronic
996478695 5:123949406-123949428 TGAGCCAGCAGCTGCGGGGGTGG - Intergenic
996937412 5:128965193-128965215 CCAGGGAGGAGCTGGCGGCGGGG + Exonic
997582088 5:135024482-135024504 ACCAGCAGGGGCTGGGGGGGTGG + Intergenic
997647637 5:135491632-135491654 TCAGGCAGGTGCAGGCCGGGCGG + Intergenic
997858025 5:137390823-137390845 TTAGGGAGTAGCTGGTGGGGGGG + Intronic
997978024 5:138451578-138451600 TCTTGCAGGGGCTGGGGGTGAGG + Intergenic
998364276 5:141618766-141618788 CCAGGCAGGAGCGGGATGGGAGG + Intronic
998805258 5:145912281-145912303 TGGGGCAGGAGCTGTGGGAGAGG + Intergenic
999273766 5:150314604-150314626 GCAGGCAGGAGGTGGGTTGGAGG - Intronic
1000002934 5:157157256-157157278 TCCAGCAGGAGATGGGGAGGGGG + Intronic
1000190581 5:158906511-158906533 ACAGGCAGGTGCAGGGGAGGAGG + Intronic
1000671176 5:164065085-164065107 CCTGGCAGGAGCAGGGAGGGAGG - Intergenic
1001073267 5:168605155-168605177 TCAGAGAGGAGCTGGGGTGAGGG + Intergenic
1001597647 5:172908295-172908317 TGAGGCGGGGGCGGGGGGGGGGG + Intronic
1001701827 5:173712393-173712415 TCAGGATGGAGTTGGGGAGGGGG - Intergenic
1002217177 5:177645874-177645896 TGAGGCGGGAGGCGGGGGGGGGG + Intergenic
1002327111 5:178416846-178416868 GCAGGGAGGAGCTGAGGGTGAGG + Intronic
1002376172 5:178790585-178790607 CCAGGCAGGGGCTGCGGGTGAGG - Intergenic
1002388279 5:178887896-178887918 TCTGGCAGGGGCAGGGGTGGGGG - Intronic
1002493495 5:179596615-179596637 TGCAGCAGGAGCTGGGCGGGAGG + Exonic
1002520785 5:179792434-179792456 TCAGGCAGGCCCTGTGGGGCAGG + Intronic
1002579875 5:180201470-180201492 GCAGGCAGGAGCTGGGGGCTTGG - Intronic
1002597228 5:180332150-180332172 TGCGGCAGGAACTGGGGAGGTGG - Intronic
1002642421 5:180636554-180636576 AAGGGCAGGAGCTGGGGTGGGGG - Intronic
1002841849 6:913135-913157 GCCGGCAGGAGGTGGGGGCGGGG - Intergenic
1002935681 6:1670147-1670169 ACAGGGAGGAGTTGAGGGGGTGG - Intronic
1003034752 6:2632954-2632976 GGAGGAAGGAGCTGGGAGGGTGG - Intronic
1003565569 6:7219493-7219515 TCAGGCAGTGGCTGGCGGGTTGG + Intronic
1003792118 6:9557805-9557827 TCAGGTAGGGGTTGGTGGGGAGG - Intergenic
1004010506 6:11681381-11681403 TCAGGCAGCAGAGGTGGGGGTGG + Intergenic
1004126930 6:12883132-12883154 TCAGGCAGGGGCTGGGGTGGGGG - Intronic
1004307307 6:14512598-14512620 GCTGGCAGGAGCTGAAGGGGAGG + Intergenic
1005968176 6:30742193-30742215 TCAGGCTGGAGCTGGAGGAGAGG + Exonic
1006026243 6:31148827-31148849 CCATGCAGGGGCTGGGGGGAGGG + Intronic
1006376288 6:33673362-33673384 TGGGGCAGGAGCTGGGGAGAGGG + Intronic
1006385679 6:33729493-33729515 ACTGGCAGGAGATGGGAGGGTGG + Intronic
1006393726 6:33773582-33773604 TGAGTCAGGAGGCGGGGGGGGGG + Intronic
1006460022 6:34152832-34152854 ACAGGCAGGAGCAAGGTGGGAGG + Intronic
1006504126 6:34476940-34476962 TGAGGCAGTAGCTCGGGGGTGGG + Intronic
1006513649 6:34534492-34534514 CCAGGCAGGAGTTGGGGTTGGGG + Exonic
1006581903 6:35082187-35082209 TCTGGCAGCAGCTAGGGGGTGGG - Intronic
1006612228 6:35301026-35301048 ACTGGCAGGAGCTGGGGGAAGGG + Intronic
1006618911 6:35348719-35348741 TCAGGAAGGTCCTGGGTGGGGGG + Intronic
1006654249 6:35576667-35576689 TCGGGCAGGGGCCCGGGGGGCGG + Intronic
1006717769 6:36131090-36131112 CCAGGCAGGAGCTGAGAGAGGGG - Intronic
1007399297 6:41594737-41594759 TCAGGGATGAGCAGGGGAGGGGG - Intronic
1007553301 6:42746435-42746457 GTAGGGAGGAGCTGGGGGGAGGG - Intergenic
1008586662 6:52957063-52957085 TCAGGGAGGAGTTAAGGGGGAGG + Intergenic
1009488368 6:64254488-64254510 CCTAGCAGGAGCTGGGAGGGAGG + Intronic
1010380981 6:75224613-75224635 TCAGGCAGTGGCTGGGGCTGGGG + Intergenic
1010467458 6:76185549-76185571 TCAGGCAAGACTTGGGGGTGTGG + Intergenic
1011267307 6:85535516-85535538 TGAGGCAGGAGCCCGGGAGGCGG + Intronic
1011556562 6:88575745-88575767 TCAGGCAGGAGGTAGAGGGAAGG + Intergenic
1011659571 6:89582640-89582662 GCTGGCAGGGGCTGGGTGGGAGG - Intronic
1013294534 6:108747042-108747064 TCAGGCCTGAGCTCGGGGGAAGG - Intergenic
1014768466 6:125434308-125434330 TCAGGCATGAGCAGGGCAGGAGG - Intergenic
1014785962 6:125619575-125619597 TGCGGCAGGAGTTGGTGGGGAGG + Intergenic
1015244516 6:131062517-131062539 GCAGGCGGCAGCTGGGGGCGCGG + Intronic
1016034548 6:139373388-139373410 TCTGGCAGCAGCTCGGGCGGCGG - Exonic
1016923431 6:149317774-149317796 TCAGCCAGGAGCGGTGGCGGCGG + Intronic
1018731007 6:166650433-166650455 TTAGGCTGGAGGTGGGAGGGAGG + Intronic
1018753897 6:166831445-166831467 TCTGGCAGGGGCAGGGGGGAAGG - Intronic
1018767252 6:166944414-166944436 ACAGGCAGGGGCTGTGGGGTAGG - Intronic
1018928769 6:168225835-168225857 TCAGGGAGGAGTGGGAGGGGTGG - Intergenic
1019021141 6:168918686-168918708 TCGGGCAGGAGATGGGGGAGGGG + Intergenic
1019511003 7:1417274-1417296 TGAGGGAGGAGTTGGGGTGGTGG - Intergenic
1019514620 7:1434272-1434294 GCAGGCAAGAGCTGGGAGGCAGG + Intronic
1019547775 7:1586754-1586776 TCAGCCTGGAGCTGGCGGGAGGG - Intergenic
1019558775 7:1645585-1645607 GCAGGCAGGGGCTGCAGGGGTGG + Intergenic
1019575936 7:1737667-1737689 TCAAGCAGGAGCTGGCGCAGAGG - Intronic
1019618842 7:1979660-1979682 GCAAGCAGGAGCTGGGGTGAGGG + Intronic
1020070398 7:5223475-5223497 GGAGGCAGGAGCTGGAGGAGCGG - Intronic
1020071477 7:5229816-5229838 CCAGTGAGGAGCTGGTGGGGTGG - Intronic
1021095134 7:16527092-16527114 TCAGGCAGGAGGTGGGGCCCTGG - Intronic
1021106746 7:16646367-16646389 TCGGGCAGGAGCTGGCGGGGAGG + Intronic
1022470413 7:30678662-30678684 TCAGGAAGCAGCTGGTTGGGTGG - Intronic
1022504301 7:30900941-30900963 TCAGGGAGGAGCTGGTGGAGCGG - Intergenic
1022857140 7:34326238-34326260 TCAGGCAGCAGCTGAGGCTGTGG + Intergenic
1022954928 7:35372175-35372197 TCAGGCAGTGTCTGGGGGGGCGG - Intergenic
1023107298 7:36774930-36774952 TCACGCTGGTGCTGAGGGGGAGG + Intergenic
1023406140 7:39834799-39834821 TTATCCAGGAGCTGGTGGGGAGG + Intergenic
1023847325 7:44129761-44129783 TCAGGGAGGGGCTGGGGGCAAGG + Intergenic
1023854857 7:44176567-44176589 TGAGGCAGCAGCTGGGGAGGTGG + Intronic
1023918371 7:44607222-44607244 TCTGGCAGCAGGTGTGGGGGCGG - Intronic
1023967169 7:44969095-44969117 TCAGGCTGGTGATGTGGGGGTGG - Intronic
1024474001 7:49791651-49791673 TCAGCCTGGAGCTGGTGGAGGGG - Intronic
1024579675 7:50792239-50792261 TCATTCAAGAGATGGGGGGGAGG - Intronic
1024854682 7:53764376-53764398 TGAGGGAGGATGTGGGGGGGCGG - Intergenic
1025164921 7:56704145-56704167 TCAGGCAGGCCCTGGGCTGGAGG - Intergenic
1025177865 7:56811040-56811062 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025178024 7:56811683-56811705 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025178442 7:56813374-56813396 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025178872 7:56815116-56815138 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025179308 7:56816906-56816928 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025179766 7:56818792-56818814 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025180215 7:56820630-56820652 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025180686 7:56822612-56822634 TGAGGCAGGAGCTGGGCCTGCGG + Intergenic
1025181129 7:56824459-56824481 TGAGGCAGGAGCTGGGCCTGCGG + Intronic
1025181561 7:56826201-56826223 TGAGGCAGGAGCTGGGCCTGCGG + Intronic
1025210637 7:57018026-57018048 CCAGGCAGGGGGTGAGGGGGTGG - Intergenic
1025661319 7:63558821-63558843 CCAGGCAGGGGGTGAGGGGGTGG + Intergenic
1025690357 7:63750779-63750801 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025690806 7:63752602-63752624 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025691246 7:63754377-63754399 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025691684 7:63756201-63756223 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025692131 7:63758024-63758046 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025692579 7:63759847-63759869 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025692993 7:63761526-63761548 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025693439 7:63763349-63763371 TGAGGCAGGAGCTGGGCCTGCGG - Intergenic
1025821364 7:64967665-64967687 CCGGGAAGGAGGTGGGGGGGGGG - Intergenic
1025976739 7:66376582-66376604 TGAGGCAGGAGCCGGGCTGGTGG + Intronic
1025976949 7:66377333-66377355 TGAGGCAGGAGCTGGGCCCGTGG + Intronic
1026045820 7:66904567-66904589 ACAGGCAGGAGCTGGGCCTGAGG - Intergenic
1026298659 7:69078248-69078270 TGAGGCAGGTGCAGGAGGGGTGG - Intergenic
1026817596 7:73524111-73524133 TCAGGGAGGCGGGGGGGGGGGGG + Intergenic
1026962675 7:74418394-74418416 TGAGGCCTGAGCTGGGGGTGGGG - Intergenic
1027140027 7:75650306-75650328 ACAGGGAGGAGCTGGCGGGCAGG - Intronic
1027202955 7:76074354-76074376 TGAGGCAGGAGCTGGGCTTGTGG + Intergenic
1027305244 7:76888029-76888051 TCATGAAGGTGCTGGGGTGGAGG - Intergenic
1027717610 7:81692741-81692763 TCAGGCAAAAGCTGGTGGGTGGG + Intergenic
1029212967 7:98923728-98923750 CCTGGCAGGGGCTGGTGGGGAGG + Intronic
1029479256 7:100802957-100802979 GAAGGCAGCAGCTGGGGGAGGGG + Exonic
1029546365 7:101212441-101212463 GCAGGAAGGAGATGGGGGTGGGG + Intronic
1029586747 7:101477517-101477539 CCAGCTAGGAGCTGAGGGGGAGG + Intronic
1030153250 7:106426895-106426917 TCAGCCAGGTGCTGGAGGGAGGG + Intergenic
1030988056 7:116265313-116265335 TCAGGGAGGAACTTGGAGGGAGG - Intergenic
1031020380 7:116621122-116621144 TCAGGCAGGAGCTCTGGGACTGG - Intergenic
1032162549 7:129521930-129521952 TGAGGAAGGAGCTGGCAGGGAGG - Intergenic
1032194535 7:129781441-129781463 CTCGGCAGGAGCTGGGGGTGGGG - Intergenic
1032240169 7:130153822-130153844 TCAGGGAGATGCTGTGGGGGAGG + Intergenic
1032533027 7:132637554-132637576 TTAGGCAGGAGCTGGGATGAGGG - Intronic
1032799011 7:135303207-135303229 TGGGGCAGGGGCTGGGGTGGGGG + Intergenic
1033165402 7:139035381-139035403 TCGCGCAGGATCCGGGGGGGCGG + Intronic
1033363018 7:140651241-140651263 CCAAGCAGGACCTGGGGGGAGGG + Intronic
1033606641 7:142932570-142932592 TCAGGCAGCTGTTGGGTGGGAGG + Intronic
1033657162 7:143381807-143381829 CCCGGCAGGAGCCGGGGTGGGGG + Intronic
1034273476 7:149814322-149814344 CCAGGCAGGTGCTGGGCAGGGGG - Intergenic
1034418081 7:150975520-150975542 GCAGTCAGGAGCTGAGGGGTGGG + Intronic
1034436044 7:151063186-151063208 TCAGGTGGGGGCTGTGGGGGTGG + Intronic
1034448562 7:151125741-151125763 CCCAGCAGGAGCTGGGGGGAGGG - Intronic
1034529698 7:151688043-151688065 TCAGCAAGGAGCCCGGGGGGGGG - Intronic
1034555998 7:151850697-151850719 TCTGGCAGAAGCCGGTGGGGCGG - Intronic
1035027268 7:155834209-155834231 TCTGGAAGGACCTGGGGGGATGG + Intergenic
1035047004 7:155974232-155974254 TCAGACAGGAGGTGAGGGTGGGG + Intergenic
1035170409 7:157014309-157014331 GCAGGGAGGAGCTGTGGTGGGGG - Intergenic
1035175108 7:157044917-157044939 TCAGGCAGGAAATGGGGCTGGGG - Intergenic
1035327241 7:158073067-158073089 TGAGGCAGGATCTGCTGGGGAGG + Intronic
1035358470 7:158294634-158294656 CCAGGCAGGAGCAAGCGGGGAGG + Intronic
1035472470 7:159119235-159119257 GCAGCCAGGAGCTGTGGGGCGGG - Intronic
1035621989 8:1042116-1042138 CCAGGCAGGTGCTGGGGCTGGGG - Intergenic
1036207894 8:6818794-6818816 TCTGGCAGGGGCTGGGGGCTGGG - Intronic
1036213336 8:6860246-6860268 ACAGGGAGGAGCAGGGAGGGAGG + Intergenic
1036471688 8:9058129-9058151 AAAGGCAGGAGCTGGAGGAGAGG + Intronic
1036510154 8:9392534-9392556 TCAGGCAGAAGCTCTGGGGGTGG + Intergenic
1036920633 8:12851078-12851100 TCCAGCAGGAGCTGGGGGAAGGG - Intergenic
1036948211 8:13115376-13115398 GCAGGCAGCAGATGGGGGAGTGG + Intronic
1036998167 8:13684474-13684496 TCTGGCAAAAGCTGGGGGGCGGG + Intergenic
1037595220 8:20349168-20349190 TCAGGGAGGAGCTGGGGGCTTGG + Intergenic
1037993699 8:23338404-23338426 TAAGGCAGCAGCGGGGTGGGGGG + Intronic
1038395806 8:27244620-27244642 TCAGACAGGAGCTGGCAGGAGGG + Intronic
1038425665 8:27462402-27462424 GCAGACAGGAGCTGGGGCAGGGG + Intronic
1038451090 8:27639414-27639436 TCAGGGAGGAGCTGAAGGGTGGG + Intronic
1038726496 8:30086833-30086855 ACAGGGAGGTGCTGGGAGGGTGG - Intergenic
1039618628 8:38976312-38976334 TGAGGCAGGAGCCTGGGAGGTGG + Intronic
1039856021 8:41414983-41415005 TCAGGCAGGAGTTTGGGGGTTGG + Intergenic
1041394413 8:57376523-57376545 TCAGCCAGGAGCATGGGGTGGGG + Intergenic
1043465836 8:80506563-80506585 TGAGGCGGGGGTTGGGGGGGGGG - Intronic
1043784498 8:84380938-84380960 TCAGACAGAAGCTGGGTGGAGGG + Intronic
1045358480 8:101410881-101410903 TCAGGCCAGAGCTGAGAGGGCGG + Intergenic
1045511596 8:102816024-102816046 CCAGGCAGGACGTGGGAGGGTGG + Intergenic
1045525977 8:102941591-102941613 ACACACAGGAGCTGGGGGAGAGG + Intronic
1045672634 8:104573389-104573411 GAAGGCAGGAGCTGTGTGGGAGG - Intronic
1045887966 8:107122679-107122701 TGAGGCAGGCGCTGGGAGTGAGG - Intergenic
1047202883 8:122781503-122781525 TCAGGCAGGAGCTGGGGGGGAGG - Exonic
1047276967 8:123413228-123413250 GCAGGGAGGAGTTGGGGGGGGGG - Intronic
1048469634 8:134695514-134695536 GCAGGCAGGGCCTGGGGGTGGGG - Intronic
1048876120 8:138837997-138838019 TGAGGTGGGAGCTGGGGGAGGGG + Intronic
1048986908 8:139739593-139739615 TCAGGATGGAGCTGGTAGGGAGG - Intronic
1049298137 8:141854777-141854799 TCTTGCAGGACCTGGGGGTGTGG + Intergenic
1049325214 8:142018037-142018059 GCAGGCAGGGCCTGGGGTGGGGG - Intergenic
1049361474 8:142214253-142214275 CCAGGCTGGAGCTGTGGGTGGGG - Intronic
1049362005 8:142216322-142216344 AGAGGCAGGGGCTGGGGGTGTGG + Intronic
1049391654 8:142374799-142374821 GCAGGGAGGGGCTGGGGCGGAGG + Intronic
1049443938 8:142621575-142621597 CCAGCCTGGAGCTGGTGGGGAGG + Intergenic
1049711947 8:144068777-144068799 GCAGCCAGGAGCTGGGAGGAAGG - Intergenic
1049756286 8:144312575-144312597 GCAGGCAGGGGCTGGGGGTGTGG - Intronic
1049826370 8:144671489-144671511 TCAGGGAGCAGGTGGGAGGGTGG - Intergenic
1049983972 9:931022-931044 TTTGGCAGGGGCTGGGAGGGAGG - Intronic
1050038897 9:1466537-1466559 TGGGGCAGGAGCTGGGAGTGAGG + Intergenic
1050426736 9:5519074-5519096 TCAGCCAGGAGGTGGGTGGGGGG + Intronic
1050668969 9:7974904-7974926 TGAGGCAGGTGCTAGGGTGGGGG - Intergenic
1051294634 9:15582775-15582797 CCTGGCAGGAGGTGGGGGGCTGG + Intronic
1051297710 9:15614370-15614392 GCAATCAGGAGCTGGTGGGGTGG + Intronic
1051567385 9:18516054-18516076 TGAGGGAGGAGCTGGAGGGATGG - Intronic
1051799958 9:20921472-20921494 TCAAGGAGGAGCTGGAGAGGTGG - Intronic
1052018189 9:23494041-23494063 TCAGGCAGGATGTAGAGGGGAGG - Intergenic
1052048508 9:23821586-23821608 GCAGGCAAGTGCTGGGGGCGTGG - Intronic
1052265102 9:26562979-26563001 TTAGGCCGGGGGTGGGGGGGGGG + Intergenic
1053064012 9:35054128-35054150 TCAGGGAAAAGGTGGGGGGGCGG + Intergenic
1053466251 9:38311012-38311034 CCAAGCTGGAGCTGGGAGGGAGG - Intergenic
1053554082 9:39116314-39116336 ACAGCCAGGAGCTGGAGGGCTGG + Intronic
1053818185 9:41936439-41936461 ACAGCCAGGAGCTGGAGGGCTGG + Intronic
1054108444 9:61080098-61080120 ACAGCCAGGAGCTGGAGGGCTGG + Intergenic
1054612413 9:67251027-67251049 ACAGCCAGGAGCTGGAGGGCTGG - Intergenic
1056565755 9:87771310-87771332 CGAGGCAGGAGTTGGGGGCGGGG - Intergenic
1056578849 9:87876015-87876037 CCAGGCAGGACCTGGACGGGAGG + Intergenic
1056762243 9:89423972-89423994 TGAGGAAGTAGCTGAGGGGGTGG - Intronic
1057140425 9:92723543-92723565 GCTGCCAGGAGCTGGGGAGGGGG + Intronic
1057199406 9:93132380-93132402 CCAGGTAGGAGGTGGGGGGATGG - Intronic
1057437369 9:95054271-95054293 TCTGGCAGGATCTGGGGTTGGGG + Intronic
1057826957 9:98378697-98378719 GCATGCAGGAGCTGGGATGGGGG + Intronic
1057937576 9:99253819-99253841 CCAGGCAGGAGGAGGGGGTGAGG - Intergenic
1058288229 9:103206386-103206408 CAAGGCAGCAGCTGGGGGGGAGG - Intergenic
1058377190 9:104336481-104336503 TCAGGTGGGAGCTGGGGGTGAGG - Intergenic
1059056778 9:110991339-110991361 TCAGGCAAGAGCTGGAGGGTGGG - Intronic
1059733206 9:117076673-117076695 TAAGGCAGGGGCAGCGGGGGTGG + Intronic
1060007871 9:120016404-120016426 TGAGGGAGGGGCTGGGTGGGAGG - Intergenic
1060157110 9:121327479-121327501 CCAGGTAGGAGCCGGGGTGGGGG + Exonic
1060219959 9:121759279-121759301 TCAGCCAGGGGCTGGGGAGTAGG - Intronic
1060269824 9:122132498-122132520 TCAGGCTGGAGCTGGGGAGGTGG + Intergenic
1060389485 9:123267169-123267191 AGGGGCAGGAGCTGGGGGAGAGG - Intronic
1060405257 9:123369835-123369857 TAAGGCAGGAGATGGGGGGTAGG + Intronic
1060495224 9:124113425-124113447 TGAGGCAGGAGAGGTGGGGGTGG + Intergenic
1060526938 9:124326203-124326225 CCTGGCAGGGGCGGGGGGGGGGG - Intronic
1060720174 9:125971305-125971327 AAAGGGAGGAGCTGGGAGGGAGG + Intergenic
1061041362 9:128142676-128142698 CCAGGCAGGTGCTGGGGCTGGGG - Intergenic
1061046675 9:128169037-128169059 GCAAGCAGGTGCTGGGGGGAGGG - Exonic
1061081651 9:128374438-128374460 ACATGCAGCAGCTGGGGTGGGGG - Intronic
1061246149 9:129402125-129402147 GCAGGGAGGAGGTGGGGAGGAGG - Intergenic
1061259885 9:129474422-129474444 TCACCCAGGAGCTGAGAGGGAGG - Intergenic
1061274693 9:129562950-129562972 AGAGACAGGAGCTGGGTGGGCGG - Intergenic
1061283117 9:129608715-129608737 CCAGGCAGGAGCCTGGTGGGAGG - Intergenic
1061293445 9:129665331-129665353 TGAGGCTGGAGCTGGGAGTGGGG + Intergenic
1061389468 9:130309604-130309626 TCAGCCTGGACCTGGGGTGGAGG + Intronic
1061416880 9:130451853-130451875 GCAGGCAGGAGATGTGGGAGGGG - Exonic
1061782864 9:133006038-133006060 GCTGGCAGGATCTGGGGGAGGGG + Intergenic
1061882675 9:133575873-133575895 TGAGGCAGGTGTTGGGGGCGCGG + Intergenic
1061926941 9:133810570-133810592 CCAGGCAGGGGCTGGGGGCAAGG - Intronic
1062118427 9:134821436-134821458 CCGGGCAGAAGCTGGGGGCGAGG - Intronic
1062165342 9:135104797-135104819 GGAGGCAGGAGGTGGGAGGGAGG - Intronic
1062178989 9:135180558-135180580 CCAGGCAGGAGGTTGGGAGGGGG + Intergenic
1062212631 9:135372977-135372999 TCAGGGAGGAGAGGTGGGGGTGG + Intergenic
1062287032 9:135777900-135777922 GCAGGGAGGAGCTGGGAGTGAGG - Intronic
1062321960 9:135994455-135994477 ACAGGGAGGAGCTGGGGTGACGG - Intergenic
1062544646 9:137055980-137056002 GCTGGCAGGAGCTGAAGGGGTGG + Intergenic
1062550692 9:137085015-137085037 ACAGGCATGTGGTGGGGGGGTGG + Intergenic
1062568509 9:137173805-137173827 TCAGGCCAGAGCTGGAGAGGTGG + Intergenic
1062598156 9:137308334-137308356 TCAAGGAGGAGCTGGGGCTGGGG - Intronic
1062623593 9:137433424-137433446 CCAGGCAGGAGGGGGAGGGGTGG - Intronic
1203492298 Un_GL000224v1:118829-118851 CAAGGCAGGCGTTGGGGGGGCGG + Intergenic
1203504921 Un_KI270741v1:60701-60723 CAAGGCAGGCGTTGGGGGGGCGG + Intergenic
1185847861 X:3456672-3456694 ACAGGCACAGGCTGGGGGGGGGG - Intergenic
1185893245 X:3838170-3838192 CCAGGCATGCGCTGGGGCGGTGG - Intronic
1185898357 X:3876592-3876614 CCAGGCATGCGCTGGGGCGGTGG - Intergenic
1185903472 X:3915021-3915043 CCAGGCATGCGCTGGGGCGGTGG - Intergenic
1186709519 X:12178769-12178791 GCAGGCTGGAGATGGGGGTGGGG + Intronic
1189187327 X:39065528-39065550 TCTGGCGGGGGCTGGCGGGGAGG + Intergenic
1189499462 X:41542312-41542334 CCAGGCAGGAGCCAGGCGGGAGG + Intronic
1189992253 X:46606610-46606632 CGAGGCAGGTGCTGGGTGGGGGG - Exonic
1190291280 X:48994089-48994111 TCAGCCAGGAGTTGGGCAGGGGG - Intronic
1192166697 X:68831178-68831200 GCAGGGCGGGGCTGGGGGGGAGG - Intronic
1193539816 X:82757655-82757677 GCAGGCAGGGGGTGGGGGGGCGG - Intergenic
1194600339 X:95913187-95913209 CCAGGCGGCAGCTGGGGGAGGGG - Intergenic
1195685133 X:107578483-107578505 TCAGGAAGGTGGTGGGGGGTGGG - Intronic
1195924810 X:110014860-110014882 TCACCCAGGAGCTCTGGGGGTGG - Intronic
1196513322 X:116540665-116540687 TCAGGCAGGGGCCAGGGGGAGGG - Intergenic
1196722129 X:118864311-118864333 ACTGGCAGGTGCTGGGTGGGAGG + Intergenic
1197183767 X:123563627-123563649 TCAGGTAGGAGCTGGGGCTGTGG - Intergenic
1197830089 X:130632353-130632375 GCAGGAAGGGGCGGGGGGGGGGG + Intronic
1198485334 X:137081556-137081578 TCAGGCAGGGGATGTGGGAGTGG + Intergenic
1199996388 X:153029150-153029172 TGAGGCAGGAGCTGCAGGTGAGG + Intergenic
1199996399 X:153029222-153029244 TGAGGCAGGAGCTGCAGGTGAGG + Intergenic
1199996438 X:153029459-153029481 TGAGGCAGGAGCTGTGGGTGAGG + Intergenic
1199996442 X:153029477-153029499 TGAGGCAGGAGCTGTGGGTGAGG + Intergenic
1199996446 X:153029495-153029517 TGAGGCAGGAGCTGCGGGTGAGG + Intergenic
1199996450 X:153029513-153029535 TGAGGCAGGAGCTGTGGGTGAGG + Intergenic
1199996604 X:153030225-153030247 ACAGGCAGGAGCTGCCTGGGCGG - Intergenic
1200034742 X:153320005-153320027 TGAGGCAGGAGCTGCAGGTGAGG - Intergenic
1200045356 X:153397994-153398016 TGAGGCAGGAGCTGCAGGTGAGG - Intergenic
1200045359 X:153398012-153398034 TGAGGCAGGAGCTGTGGGTGAGG - Intergenic
1200045366 X:153398048-153398070 TGAGGCAGGAGCTGTGGGTGAGG - Intergenic
1200134810 X:153869768-153869790 TCAGGCAGGAGTGGGGAGTGTGG - Intronic
1200292715 X:154887221-154887243 TCCGGCAGCAGCTTGGCGGGCGG - Exonic
1200339559 X:155382961-155382983 TCCGGCAGCAGCTTGGCGGGCGG - Exonic
1200346911 X:155457732-155457754 TCCGGCAGCAGCTTGGCGGGCGG + Exonic
1200786241 Y:7263350-7263372 TTAGGAAGGCGGTGGGGGGGGGG - Intergenic
1202075906 Y:21037861-21037883 GCAGACAGGAGTGGGGGGGGGGG - Intergenic