ID: 1047202884

View in Genome Browser
Species Human (GRCh38)
Location 8:122781506-122781528
Sequence TTTTCAGGCAGGAGCTGGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 384}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202884_1047202892 -8 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202884_1047202897 7 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202884_1047202896 6 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202884_1047202894 4 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202884_1047202895 5 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202884_1047202893 1 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202884 Original CRISPR TTTTCAGGCAGGAGCTGGGG GGG (reversed) Exonic
900567033 1:3338611-3338633 TTATCAGGCCGGAGGTGGAGGGG - Intronic
900636288 1:3667432-3667454 CTATCAGGCAAGAGCTGGAGAGG - Intronic
900709104 1:4101236-4101258 TTTCCAGGCAGCAGCAGGGGAGG - Intergenic
900878060 1:5360111-5360133 TTTACAGCCAGGAGCAGGGTGGG + Intergenic
900959746 1:5911262-5911284 TTTTCTGGGAGGAGGTGGGCAGG - Intronic
901066005 1:6495012-6495034 TGCTCAGGCAGGGGCAGGGGTGG - Intronic
902300156 1:15495962-15495984 TTTTCAGGTAAGAGCAGGGTAGG - Intronic
902436437 1:16400879-16400901 TTTTCTGGTAGTAGCTGGGGAGG + Exonic
903344423 1:22675358-22675380 TTAGCAGGCAGGAGATGGGCAGG - Intergenic
904010409 1:27386571-27386593 CATTCAGGCAAGAGATGGGGAGG - Intergenic
904041542 1:27588000-27588022 TTTGCTGGCAGGACCAGGGGAGG - Intronic
904318175 1:29679561-29679583 TTTCCAGCCAGGAGCTGGTCGGG + Intergenic
904341332 1:29836898-29836920 GGTTCAGGAAGGAGCTGGAGGGG - Intergenic
904425483 1:30420032-30420054 TTCACAGGCAGGAGCAGGGAAGG + Intergenic
904495176 1:30882476-30882498 TTTTAGAGCAGCAGCTGGGGAGG + Intronic
906362617 1:45176672-45176694 TTGGCAGGGAGGAGCTGTGGTGG - Intronic
907428518 1:54396810-54396832 TTTCAAGGCGGGAGGTGGGGCGG - Intronic
907459322 1:54595970-54595992 CTTGGAGGCCGGAGCTGGGGAGG + Intronic
907550527 1:55301162-55301184 TTCTCAGGCAGAATCTGGGCCGG + Intergenic
909477121 1:76093640-76093662 TCTTCAGGCAGAAAATGGGGAGG - Intronic
909478887 1:76112248-76112270 TGTCCAGGAAGGAGGTGGGGGGG - Intronic
910219683 1:84877708-84877730 CTCTCAGTCAGGAGGTGGGGTGG + Intronic
911641792 1:100297678-100297700 TTTTCACGAAGGAGCATGGGGGG - Intergenic
912265576 1:108153721-108153743 GTCTCAGGAAGGAGCTTGGGTGG + Intronic
912273295 1:108231321-108231343 TTTTCAGGCACCAGGTTGGGGGG + Intronic
912294925 1:108463001-108463023 TTTTCAGGCACCAGGTTGGGGGG - Intronic
913090158 1:115471404-115471426 TTTTCCAGCAGGGACTGGGGTGG - Intergenic
913280615 1:117181716-117181738 GTTTGAGACAGGAGCTGGGAGGG + Intronic
913445787 1:118949478-118949500 TTTTCATCCAAGAGTTGGGGAGG - Intronic
915724199 1:158006339-158006361 TTTCCATGCAGGAGCAGGGAAGG - Intronic
916226162 1:162491470-162491492 TTTTCAGGCAAGAGCTAGCTGGG + Intergenic
916385696 1:164265405-164265427 TTGTCTGGCAGGAGCTGTTGAGG + Intergenic
916690416 1:167184977-167184999 TTCTCAGACAGGTGCTGGGCTGG + Intergenic
917839973 1:178969668-178969690 TGTTGGGGCAGGAGCAGGGGAGG + Intergenic
919774525 1:201185454-201185476 TATGCTGGCAGGAGATGGGGAGG - Intergenic
919833614 1:201558930-201558952 TTGAGAGGCAGGAGTTGGGGTGG + Intergenic
921801551 1:219408602-219408624 GATTCTGGCAGGGGCTGGGGGGG + Intergenic
921993747 1:221395388-221395410 TTTCCAGGCATGAGCTAGGATGG - Intergenic
922866623 1:228866121-228866143 TTTTAGGGCAGGTGCTAGGGAGG + Intergenic
923129848 1:231065703-231065725 TTTTCCGGGAGGTGCTGGGATGG + Intergenic
923437875 1:233984999-233985021 TTTTCATGCAGGGGTTGGGGGGG + Intronic
923570479 1:235108751-235108773 GTTTGTGGCAGGAGCTGTGGAGG + Intergenic
923668425 1:236019164-236019186 TATGCAAGCTGGAGCTGGGGAGG + Intronic
924587680 1:245374437-245374459 TTTTCAAGAAGGAACAGGGGTGG + Intronic
924946636 1:248851006-248851028 TTGGCGGGCAGGGGCTGGGGTGG - Intronic
1063164275 10:3445690-3445712 ATTTCAGGCAGGAACTGCGGTGG + Intergenic
1064232466 10:13541404-13541426 GGTTCAGGCAGGAGCAGGTGAGG - Intergenic
1064700104 10:18009601-18009623 TTTGCAGGCAGGGGATTGGGGGG + Intronic
1065917292 10:30364660-30364682 TGGCCAGGCAGGAGCAGGGGAGG - Intronic
1068677962 10:59787384-59787406 TTTGAACGCAGGAGGTGGGGAGG + Intergenic
1069005567 10:63314270-63314292 TTCTCAGGCAGGGGATGTGGTGG + Intronic
1069949883 10:72011465-72011487 TTTTCAGCTTGGAGCTGGGATGG + Exonic
1070368949 10:75763709-75763731 TTTTTTGGCAGGTGTTGGGGAGG + Intronic
1070675075 10:78406693-78406715 TGTTCAGGTAGGAGATGGTGTGG + Intergenic
1074107663 10:110400456-110400478 ACTTCAGGCAGGAGGTAGGGAGG + Intergenic
1074710668 10:116174952-116174974 TTTGCAGGCAGGATCCGTGGTGG - Intronic
1074786737 10:116848768-116848790 GATTCAGGCAGGACTTGGGGAGG - Intergenic
1074954013 10:118369988-118370010 CCTTCAGGCAGGCCCTGGGGTGG - Intergenic
1075015252 10:118905875-118905897 TCTCCAGGCAGGAGGTGGTGGGG + Intergenic
1075713235 10:124541886-124541908 TCCCCAGGTAGGAGCTGGGGAGG - Intronic
1076114766 10:127887682-127887704 TTCTGAGCCAGGAGCTGGAGCGG - Intronic
1076874583 10:133209807-133209829 GTCTCAGGCAGGAGATGGCGTGG - Intronic
1077391747 11:2303539-2303561 CTCTCAGGCAGGAGCTCAGGGGG + Intronic
1077714295 11:4566294-4566316 TTTTTAGGCAGAAAGTGGGGAGG - Intergenic
1078157481 11:8811175-8811197 TTTCCGGGCAGCAGTTGGGGCGG + Intronic
1078182914 11:9027546-9027568 TTTTCAGACAGAAGATGTGGAGG - Exonic
1079339586 11:19601178-19601200 TTTGCAGGCAGGAGCTCTGAAGG - Intronic
1079827204 11:25212025-25212047 TTTTCAGGCAGCAGGTGAGCAGG + Intergenic
1080249444 11:30216645-30216667 ATCTGAGGCAGGAGCAGGGGTGG + Intergenic
1080465287 11:32490609-32490631 TTTCCAGGCAGGAGCTCAGGAGG - Intergenic
1082930841 11:58603463-58603485 TTTTCAGGAAAGATCTGTGGAGG + Intronic
1083288509 11:61676551-61676573 TGAGCAGACAGGAGCTGGGGAGG - Intergenic
1083384358 11:62296668-62296690 TTTTCATGGAGGAGGAGGGGAGG + Intronic
1083398960 11:62411013-62411035 TGTACAGGGAGGAGCTGGCGTGG - Intronic
1084238861 11:67805482-67805504 TTATGAGGCGGGACCTGGGGTGG + Intergenic
1084507299 11:69576187-69576209 TTTTCAGACTGGAGCAGGGCAGG + Intergenic
1084652699 11:70498522-70498544 CTGTCAGGCAGGATTTGGGGTGG - Intronic
1085184044 11:74560172-74560194 ACTTCAGGGAGGAGGTGGGGTGG + Intronic
1085316161 11:75546290-75546312 CTGTCAGGCATGAGCTGGGGCGG + Intergenic
1085830725 11:79898048-79898070 TATTTAGGCAGTTGCTGGGGCGG + Intergenic
1088207072 11:107404536-107404558 TTGTGTTGCAGGAGCTGGGGTGG + Intronic
1088719214 11:112577018-112577040 GATTCAGGCAGGGGCTGAGGAGG + Intergenic
1089573097 11:119422952-119422974 TTTCCAGGCAGGGGCGGGAGGGG - Intronic
1089780458 11:120869984-120870006 TGCTCAGGCTGGAGCTGGGCTGG + Intronic
1090079317 11:123600950-123600972 TTTGCAGGAAGGAGTAGGGGAGG + Intronic
1091139729 11:133224553-133224575 GGTTCAGGCAGGATCTGGGCAGG - Intronic
1091239243 11:134041626-134041648 GTGTGAGGCAGGGGCTGGGGTGG - Intergenic
1092508624 12:9128820-9128842 TTCTCTGGCAGAAGCTGGAGTGG + Intergenic
1092785128 12:12019676-12019698 TTTTATTGCAGGAGGTGGGGAGG - Intergenic
1093413685 12:18896073-18896095 TTTTCCGGCTGGAGCCAGGGAGG - Intergenic
1095328405 12:40926610-40926632 TTTTAAGAAAGGACCTGGGGAGG + Intronic
1095950556 12:47779632-47779654 TTTTCAGGCAGGAGGCCGTGGGG - Intronic
1096578843 12:52571508-52571530 CTTTGAGGCAGGAGTTGGGCAGG - Intronic
1097155276 12:57007405-57007427 TTTTCAGGCAGTGACTGGGATGG - Intergenic
1098046548 12:66407230-66407252 GCTACAGGCAGGAGGTGGGGAGG - Intronic
1101877301 12:108604250-108604272 TGTCCATGCAGGAGCTGGTGTGG - Intergenic
1102234429 12:111285470-111285492 CTTTCAGGGAGCAGGTGGGGTGG - Intronic
1102237617 12:111304120-111304142 GTTTCAGGCAGGGGTTGGGGAGG - Intronic
1102702025 12:114847694-114847716 TTTCCAAACAGGAGTTGGGGGGG + Intergenic
1102768853 12:115455697-115455719 GTTTCAGGCTGGAGCTGTGTTGG - Intergenic
1103477183 12:121227376-121227398 TTGTCAGCCAGGAGCTGACGTGG + Intronic
1104001679 12:124864096-124864118 TTTTGGGGCGGGAGCTGAGGAGG + Intronic
1104127568 12:125861996-125862018 TCTTCTGGGAGCAGCTGGGGTGG + Intergenic
1104718780 12:131033248-131033270 TTGTGTGGCAGGGGCTGGGGTGG + Intronic
1106430965 13:29680235-29680257 TTTTTTGGCAGGGGCTGGGGGGG + Intergenic
1106628448 13:31444632-31444654 TTTGAAGGCAGGAGCTGAGGAGG - Intergenic
1107157831 13:37190440-37190462 TTTTGAGGTAGGAGGTAGGGAGG + Intergenic
1107429967 13:40331857-40331879 CTTTGTGGCAGGAACTGGGGAGG - Intergenic
1107484587 13:40813664-40813686 TGATCAGGCAGGAGCTGTGCTGG - Intergenic
1107853759 13:44594889-44594911 TTGTGTTGCAGGAGCTGGGGTGG - Intergenic
1109229668 13:59741602-59741624 TGGTCAGGCAGGAGCTGAGGTGG + Intronic
1111745179 13:92259431-92259453 TTTTCAATCAGGAGTAGGGGAGG - Intronic
1112086668 13:96039394-96039416 TATCCAGGAAGGATCTGGGGAGG - Intronic
1112203827 13:97304043-97304065 CTTTCAGGAAGTAACTGGGGAGG + Intronic
1113601461 13:111572184-111572206 ATATCAGGAAGGAGCTGGAGGGG + Intergenic
1114620598 14:24094143-24094165 TTTGGAGGCAGGGGTTGGGGCGG + Exonic
1115782693 14:36787051-36787073 GTGTCAGGCAGGGACTGGGGTGG + Intronic
1116708499 14:48334953-48334975 TACTCAGGCATGAGCAGGGGAGG + Intergenic
1118398041 14:65354354-65354376 TTTCCAGGCTTGGGCTGGGGAGG + Intergenic
1118849939 14:69575368-69575390 TTTTCAAGAATTAGCTGGGGTGG + Intergenic
1118890600 14:69905257-69905279 TTCTAAGGCAGGAGTTGGAGAGG + Intronic
1118906907 14:70029882-70029904 TTTTCAACCTGGGGCTGGGGTGG - Intronic
1121932273 14:97983161-97983183 TTTTCTGGCAGGGGGTGGGAGGG + Intergenic
1122178347 14:99937250-99937272 GTGTCAGGCAGGAGCTGGACAGG - Intronic
1122617793 14:103032293-103032315 ATTCCAGTCAGGAGCTGGTGAGG - Intronic
1124515086 15:30361070-30361092 TTTTGGGGCTGCAGCTGGGGTGG + Intergenic
1124727836 15:32169657-32169679 TTTTGGGGCTGCAGCTGGGGTGG - Intronic
1125191807 15:37002262-37002284 TTTGAAGGCAGGTGATGGGGTGG - Intronic
1125877302 15:43161116-43161138 TTTTCAGGCATCCACTGGGGGGG + Intronic
1127264034 15:57346842-57346864 TTGTCAGTCAGAATCTGGGGTGG + Intergenic
1128092217 15:64926739-64926761 TTTCCAGGCAGGGTGTGGGGAGG + Intronic
1128114684 15:65097814-65097836 CTTTCAAACAGGAGCCGGGGTGG - Intronic
1128315231 15:66655625-66655647 GTTCCAGGCCGGGGCTGGGGAGG - Intronic
1128667750 15:69550930-69550952 TTTTCAGTCAGGTGCTGTGCTGG + Intergenic
1129231669 15:74200502-74200524 CTCTCAGGCTGGAGTTGGGGTGG - Intronic
1129476372 15:75786706-75786728 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1129728302 15:77915352-77915374 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic
1129771193 15:78204515-78204537 TGTCCAGGCAGGGGCTGGGTGGG + Intronic
1130063574 15:80586997-80587019 TTTATGGGCAGGAGCTGGGGAGG - Intronic
1130161714 15:81407941-81407963 TTTGCGGGCAGGAGCTGGGGAGG + Intergenic
1130259267 15:82343072-82343094 TGGGCAGGCAGGAGCAGGGGAGG - Intronic
1130269409 15:82436093-82436115 TGGGCAGGCAGGAGCAGGGGAGG + Intronic
1130276014 15:82476740-82476762 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic
1130281997 15:82526110-82526132 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1130468374 15:84204131-84204153 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic
1130473364 15:84242273-84242295 TGGGCAGGCAGGAGCAGGGGAGG + Intronic
1130480778 15:84356337-84356359 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1130485376 15:84395619-84395641 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1130490934 15:84431422-84431444 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic
1130495892 15:84469411-84469433 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1130502518 15:84510221-84510243 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic
1130590667 15:85208729-85208751 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic
1130595644 15:85246852-85246874 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1131188703 15:90295496-90295518 TGAGCAGGCAGGAGCAGGGGAGG + Intronic
1131271168 15:90948465-90948487 TCTTCTTGGAGGAGCTGGGGAGG + Intronic
1131854871 15:96582869-96582891 AGTGCAGGCAGGAGCTGGTGGGG - Intergenic
1132059732 15:98682247-98682269 TTTTCCAGGAGGAGCTGGGAAGG + Intronic
1133211847 16:4267641-4267663 GTTTGAGGCTGGAGCTGGGCAGG - Intronic
1133736850 16:8622205-8622227 ATTTAGGCCAGGAGCTGGGGAGG - Intronic
1133896964 16:9938882-9938904 TTTCCGGTCATGAGCTGGGGTGG - Intronic
1134228763 16:12413009-12413031 TTATCAGGCAAGGGCTGGGGAGG + Intronic
1134451824 16:14368442-14368464 GTTCCAGGCTTGAGCTGGGGTGG + Intergenic
1136061491 16:27729755-27729777 TTGTGAGCCAGGAGCTGGCGCGG - Intronic
1136507122 16:30711757-30711779 TCATGAAGCAGGAGCTGGGGAGG + Intronic
1137607711 16:49797546-49797568 TGTTCAGGCAGTGGGTGGGGTGG + Intronic
1137869079 16:51932211-51932233 TGTTCAGGTTGGAGATGGGGTGG - Intergenic
1138411979 16:56847730-56847752 TTTTCACTCACGAGCTGGGCGGG + Intronic
1140700226 16:77574752-77574774 TTTTTTGGCAGGGGCTGAGGGGG + Intergenic
1141067469 16:80925681-80925703 TCTTCAGGCAGGAGCGGGCTGGG + Intergenic
1141448843 16:84082875-84082897 TCATCAGGCTGGAGCTCGGGAGG + Intronic
1142181448 16:88672840-88672862 TTTCTGGGAAGGAGCTGGGGTGG + Intergenic
1142268515 16:89077345-89077367 CCTTGAGGCAGGAGCTGGGCTGG - Intergenic
1142495355 17:303527-303549 GTTTCAGGAAAGAGATGGGGAGG + Intronic
1142495366 17:303596-303618 GTTTCAGGAAAGAGATGGGGAGG + Intronic
1142495444 17:304079-304101 GTTTCAGGAAAGAGATGGGGAGG + Intronic
1143822919 17:9579071-9579093 TGTTCAGTCAGTGGCTGGGGTGG + Intronic
1144648085 17:16988906-16988928 ATATCAGGCAGGACCTGGGCAGG - Intergenic
1144799751 17:17917678-17917700 TTTACAGGCATGAGCTGGCCTGG - Intronic
1145782529 17:27572427-27572449 TCTTTAGACAGAAGCTGGGGTGG + Intronic
1147314365 17:39612569-39612591 ATGTGAGGCAGGGGCTGGGGAGG - Intergenic
1147516653 17:41124038-41124060 TGGTCTGGCAGCAGCTGGGGCGG + Exonic
1147518944 17:41149683-41149705 TGGTCTGGCAGCAGCTGGGGCGG + Exonic
1147520541 17:41168076-41168098 TGGTCTGGCAGCAGCTGGGGCGG + Exonic
1147522241 17:41184758-41184780 TGGTCTGGCAGCAGCTGGGGCGG + Exonic
1148455874 17:47811139-47811161 GTTTCAGGCAGGGCATGGGGTGG - Intronic
1148473115 17:47908087-47908109 ATTTCAGGAACCAGCTGGGGAGG + Intronic
1149336451 17:55640946-55640968 TTTACTGGAAGGAGGTGGGGAGG + Intergenic
1149345186 17:55727449-55727471 TTTTCAGGGAGGAGAAGGGAAGG + Intronic
1149602683 17:57903456-57903478 CTTTCAGGAAGGAGCTAGGAGGG + Intronic
1150491906 17:65580188-65580210 GCTTCAGGAAGGGGCTGGGGTGG - Intronic
1150711093 17:67531537-67531559 TTCTGAGGCAGGAGCAGGGACGG - Intronic
1150984954 17:70185423-70185445 TTTCCAGGGAGGAGCTGAAGTGG + Intergenic
1151309507 17:73284899-73284921 TTCCAGGGCAGGAGCTGGGGTGG + Exonic
1151370680 17:73644691-73644713 TTTGCAGGCAGCATCTGGCGGGG + Intergenic
1151485823 17:74398980-74399002 TTTCTAGGCAGAGGCTGGGGTGG - Intergenic
1151680610 17:75620817-75620839 CTTGCAGGCAGGGGCTGGGCTGG + Intergenic
1151815258 17:76468572-76468594 TTTTGTAGCAGGAACTGGGGTGG - Intronic
1151853931 17:76708725-76708747 TTTGCAGGCAGGAGTTTTGGGGG + Intronic
1152029647 17:77834147-77834169 TTTTCAATCAGCTGCTGGGGTGG - Intergenic
1152371331 17:79890524-79890546 TTTCCAGGAAGGATCTGTGGGGG + Intergenic
1152436489 17:80279331-80279353 TGTTCAGGCAGAGGCTGGGTCGG - Intronic
1152667545 17:81580067-81580089 CTGGGAGGCAGGAGCTGGGGAGG - Intronic
1155839961 18:30632039-30632061 TTTGCAGCCAGCAGCTGGCGAGG + Intergenic
1156496785 18:37531025-37531047 TGCTGAGGCAGGAGCTGGGGTGG + Intronic
1157047898 18:44124871-44124893 TTTCCAGGAAGAAGATGGGGCGG - Intergenic
1157212922 18:45759351-45759373 TTTTCATGCAAGAGGTGGGTAGG - Intergenic
1157542165 18:48518781-48518803 TTTTAAGGAAGGAGTTGGGAGGG + Intergenic
1158345019 18:56507573-56507595 TTTTCAGGCAGGAGTTGTGAAGG - Intergenic
1159093946 18:63881036-63881058 TTTAGGGGCAGGTGCTGGGGTGG - Intronic
1160236062 18:77087747-77087769 CTTCCAGGCAGGCGCTGGGATGG + Intronic
1162008048 19:7792452-7792474 TTATCAGGCTGCAGCTGGTGGGG + Intergenic
1163211246 19:15841976-15841998 TTGTGAGACAGGGGCTGGGGTGG + Intergenic
1163458153 19:17420672-17420694 CTTGCAGGGAGGAGCGGGGGAGG + Intronic
1164959273 19:32413720-32413742 TTTTTTGGGAGGAGCGGGGGCGG + Intronic
1165047601 19:33117962-33117984 TGATCAGGCAGGCTCTGGGGAGG + Exonic
1165361060 19:35337355-35337377 CTTTGAGGCAGCAGCTGGGTGGG + Intronic
1166668194 19:44694199-44694221 TTTTCTGGAAGGTGCTGGAGGGG - Intergenic
1166839540 19:45688319-45688341 TCTTCAGACTGGAGCTGGAGTGG + Intronic
1166889449 19:45981609-45981631 TGTTGAGGCTGGAGCGGGGGAGG - Intergenic
925714251 2:6770352-6770374 TGTTGAGGCAGGGGCTGAGGAGG - Intergenic
926306035 2:11637794-11637816 TTCTCCAGCAGGAGCTGGGCGGG - Exonic
926425056 2:12732538-12732560 ATTTGAGGTAGGAGTTGGGGTGG + Intronic
927806237 2:26149235-26149257 TTGTGTTGCAGGAGCTGGGGTGG - Intergenic
929172186 2:38943300-38943322 TCTTCAGGCAGGAGATTGGAGGG - Intronic
929216198 2:39416156-39416178 TTTTCAGTCAGATGCTGGGAGGG + Intronic
929353285 2:40987527-40987549 TATTCAGGAGGTAGCTGGGGAGG - Intergenic
929454850 2:42058311-42058333 GTTTGAGCCAGGACCTGGGGCGG + Exonic
929541265 2:42824244-42824266 GTTTCCTGCAGGAGCTGAGGGGG + Intergenic
929593021 2:43159102-43159124 GTTGCAGGCAGGAGCAGGCGTGG - Intergenic
931617749 2:64177720-64177742 CTTTCAGGAATGAGCTGGGAGGG - Intergenic
932693778 2:73936499-73936521 TATTCAGAGAGGAGTTGGGGTGG + Intronic
933291304 2:80441349-80441371 TTTTCAGGAAGGAGTAGGGCAGG + Intronic
934518779 2:95006259-95006281 TTTTCAAGCCTGGGCTGGGGAGG + Intergenic
934691659 2:96365399-96365421 TCTTCGGGCAGGGGGTGGGGTGG - Intronic
936561128 2:113541012-113541034 TTCTAAGGCAGGAGCTGGGTAGG + Intergenic
937024802 2:118689244-118689266 TTAACAGGGAGGAGGTGGGGTGG - Intergenic
937777005 2:125789785-125789807 TTTTCAGGACAGAGCTGGGGTGG - Intergenic
938082092 2:128375596-128375618 GTGTCAGGCAGCAGCTGGGCTGG + Intergenic
938603888 2:132872549-132872571 TTCTCAGCCAAGGGCTGGGGTGG + Intronic
938794428 2:134706069-134706091 TTTCCAGCCAGGAGTGGGGGAGG - Intronic
939733319 2:145812232-145812254 TCTCCAGGAAGGAGCTAGGGAGG + Intergenic
939989893 2:148867583-148867605 ATCTCAGCCAGGAGCTGGTGGGG + Intergenic
940011229 2:149057821-149057843 GTTTCAGGGGTGAGCTGGGGTGG + Intronic
940484625 2:154281828-154281850 TTTTGAGGGAGCAGCTGGTGGGG - Intronic
941291649 2:163683141-163683163 CTTTGAGGCATGGGCTGGGGAGG - Intronic
941717570 2:168779953-168779975 TTTTTGGGCAGGAACTGGCGTGG - Intergenic
943536118 2:189152737-189152759 TTTTCAGAAATGAGCTAGGGTGG + Intronic
943561367 2:189467097-189467119 GTTTCAGGCATCAACTGGGGCGG - Intronic
945406165 2:209451470-209451492 TTTCCTGGCAGTAGCTGTGGTGG + Intronic
945471085 2:210228630-210228652 TTTGCAGGCAGGAACTGGAGTGG + Intergenic
946367400 2:219257358-219257380 TTTTGAGGCAGGATCTTGGCCGG + Intronic
948240565 2:236429646-236429668 TGTGGAGGCAGTAGCTGGGGTGG + Intronic
1169282974 20:4282771-4282793 ATTCCAGGCAGGAGATGGGAGGG + Intergenic
1169912175 20:10655929-10655951 TTTGCAGGCGGGAGCTGGGTTGG - Intronic
1171052221 20:21870682-21870704 TTTGCAGTCAGGGGCAGGGGAGG + Intergenic
1173222685 20:41142448-41142470 TTGTCAGGCAGGTGTTGGGGAGG + Intronic
1173341128 20:42154008-42154030 TTTTCAATCTGGAGGTGGGGTGG + Intronic
1174106868 20:48168564-48168586 TGTTCAGGCAGGAGCAGAGCAGG + Intergenic
1174254412 20:49243539-49243561 GCTTCATGTAGGAGCTGGGGAGG + Intronic
1174284706 20:49464527-49464549 TTTTCAGGCAGGGAGTGGAGGGG - Intronic
1174390749 20:50217016-50217038 GCTTCAGGCAGGGGCTGGGGTGG - Intergenic
1175311623 20:58015854-58015876 TTTTCATGGAGGATGTGGGGCGG - Intergenic
1178232278 21:30799864-30799886 TTTTCTGGCGGGGGATGGGGAGG + Intergenic
1179250933 21:39670671-39670693 TTTACAGGCAAGAACTGAGGAGG + Exonic
1179603617 21:42497222-42497244 TGTTGCTGCAGGAGCTGGGGAGG + Intronic
1181439304 22:22927545-22927567 TGTTCAGCCAGGTGCTGGGCTGG + Intergenic
1182070833 22:27462548-27462570 TTGGCAGGCAGGAGCTGGGGAGG + Intergenic
1182111246 22:27725253-27725275 TTTCCAGCCAGCAGCTGGGAAGG - Intergenic
1183342184 22:37287554-37287576 TCTTCCGGCAGGAGCTGGCGGGG - Intronic
1183404897 22:37625645-37625667 TTTCCAGGCAGGGGCTGGTGTGG + Intronic
1183586257 22:38755010-38755032 TTGTTAGGGAGGAGGTGGGGCGG - Intronic
1184652333 22:45925008-45925030 TCATCAGGCAGGTGCTGGGTGGG + Intronic
1184751806 22:46490578-46490600 TTTTCAAGCAGGACCTGGGAGGG + Intronic
1184864662 22:47195530-47195552 TTTCCAGGCAGGAGTCAGGGTGG + Intergenic
1185276797 22:49953419-49953441 TGTTCAGGGATGAGCTGGGCAGG + Intergenic
949414847 3:3802455-3802477 TTTTCTGGCGGGGGTTGGGGGGG - Intronic
950072602 3:10164777-10164799 TTCTCTGGCCGGCGCTGGGGTGG + Intergenic
950520676 3:13496037-13496059 TTTTCAGCCAGGAGATGGCTTGG + Intronic
950614996 3:14151058-14151080 TACTGAGGCAGGAGCTGGGGTGG + Intronic
950717779 3:14861989-14862011 TGTTCAGGCAGGAGGTGGCCTGG + Intronic
950965310 3:17141986-17142008 TTTGCAGGAAGGAGCAGGGAGGG - Intergenic
951991174 3:28677638-28677660 TTCGCAGGCAGGAACTGGAGTGG + Intergenic
952392551 3:32892814-32892836 TTTTCAGGCATGGGCTGACGTGG + Exonic
954143311 3:48621419-48621441 TATTGAGGCAGGGGCTGTGGGGG + Intronic
954327526 3:49871572-49871594 TTTTTAGGCAGGGGAAGGGGTGG + Intergenic
954410877 3:50370400-50370422 TTATCCGGCGGGGGCTGGGGAGG + Intronic
954793722 3:53150740-53150762 TTTCCAGGCAGAAACTGGAGGGG - Intergenic
956169868 3:66424407-66424429 CTCTCAGGCAGGAGGTGGGAAGG - Intronic
957338141 3:78858759-78858781 TTTTCTGGCGGGGGGTGGGGTGG - Intronic
957578661 3:82042266-82042288 TTTTCATGGAGGAGATGGGAAGG - Intergenic
959056300 3:101571170-101571192 TTGAGAGGCAGGAGGTGGGGTGG - Intergenic
960028407 3:113033543-113033565 CTCTCAGGCAGGAGCTGAAGAGG + Intergenic
960029586 3:113043858-113043880 TTTTCAGGGAGGAGAGTGGGAGG - Intergenic
960629140 3:119711507-119711529 TATTTAGGGAGGAGTTGGGGAGG - Intronic
961233816 3:125345825-125345847 TTTTTTGGCAGCAGTTGGGGGGG - Intronic
962204336 3:133422753-133422775 TATTCTGGCAGGTGCTGGGCTGG - Intronic
962317954 3:134370572-134370594 TTCTCAGGTTGGAGGTGGGGTGG + Intronic
963369800 3:144384427-144384449 CTCTCTGGCAGGATCTGGGGAGG + Intergenic
968069135 3:195775117-195775139 TTTCCAAGCAGGACCAGGGGAGG - Intronic
969238952 4:5887438-5887460 ATGCCAGGCAGGAACTGGGGCGG + Intronic
969355484 4:6622888-6622910 TGGCCAGGCAGGAGCTGGGCTGG + Exonic
969393823 4:6908364-6908386 TTTACAGCCATGAGCTGGAGAGG + Intergenic
971353548 4:25873762-25873784 TTTTAGGCCAGGAGCTGGGAGGG - Intronic
973636175 4:52863190-52863212 TTTCCAGGCAGGGGGTGGGGTGG + Intronic
974353065 4:60774325-60774347 TACTGAGGCAGCAGCTGGGGTGG - Intergenic
975468853 4:74740836-74740858 TTTTAAGGAAGGAGTTGGGAAGG + Intergenic
975581446 4:75910488-75910510 TTTTCAGGAAGAAAATGGGGAGG + Intergenic
975671703 4:76787039-76787061 CTTTCAGGCCGGAGCTGAAGTGG + Intergenic
975757632 4:77586897-77586919 TTTGTAGGCAGGAGATGTGGGGG - Intronic
977825242 4:101523672-101523694 TTTTGAGGCAGGAGACTGGGAGG + Intronic
977933836 4:102778801-102778823 TTCGCAGGCAGGAACTGGAGTGG + Intergenic
978271262 4:106893388-106893410 TGTTCAGGCAGAGGCAGGGGGGG - Intergenic
979021487 4:115504461-115504483 TTTTCAGGACTGAGCTAGGGAGG - Intergenic
980107326 4:128600322-128600344 TTTTTAAGCATGAGCAGGGGTGG - Intergenic
980802287 4:137767754-137767776 TTATCAGGCAGTAGCTGGATGGG + Intergenic
983871877 4:172832920-172832942 TTTTCTAGCTGGAGCTGGTGGGG - Intronic
984766430 4:183403976-183403998 TTCTCAGGCTGGGGCTGGGTGGG - Intergenic
985748694 5:1662106-1662128 TATTCTGCCGGGAGCTGGGGTGG - Intergenic
985757356 5:1726875-1726897 TGTTCAGGCTTGAGCTGGGTGGG + Intergenic
985979660 5:3451962-3451984 TTTGCAGACAAGAGCTGGGGAGG - Intergenic
986399052 5:7361641-7361663 TTGTAAGCCTGGAGCTGGGGAGG + Intergenic
986501167 5:8401293-8401315 TTTTCATGGAAGATCTGGGGTGG - Intergenic
986612868 5:9587340-9587362 TTCACAGGCAGGGCCTGGGGAGG + Intergenic
986643168 5:9891837-9891859 TTGTTGGGCAGGAGCTGGAGTGG - Intergenic
987212255 5:15694754-15694776 TTTTAAGGCAGGAGCTGGGGAGG + Intronic
988829224 5:34971244-34971266 TTTTTAGGCAGGAGATTAGGTGG + Intergenic
990380567 5:55218656-55218678 TTCTGAGGCAGGGGTTGGGGTGG - Intergenic
991256459 5:64619976-64619998 TTTTCGGGGAAGAGATGGGGAGG - Intergenic
993478046 5:88389035-88389057 TTTTGAAGCTTGAGCTGGGGCGG + Intergenic
993504039 5:88690496-88690518 TTTTAACGCGGGAGCTAGGGGGG - Intergenic
993522033 5:88914923-88914945 TGTTCAGGCAGAAGCAGAGGAGG - Intergenic
994559525 5:101349489-101349511 TTTACAGGCAGCAGATGGGTGGG - Intergenic
997617975 5:135265630-135265652 TGGACAGGCAGGAGCTGGGAAGG + Intronic
998511661 5:142718969-142718991 ATAGCAGGGAGGAGCTGGGGTGG + Intergenic
998549496 5:143063717-143063739 TTGGCAGGCAGAGGCTGGGGAGG - Intronic
1001774072 5:174315627-174315649 TGGTCAGGCTGGAGGTGGGGCGG + Intergenic
1002279803 5:178123581-178123603 GTGTGAGGCATGAGCTGGGGGGG + Exonic
1002375024 5:178782520-178782542 TTTTCAGGCAGCAGTGGGAGAGG + Intergenic
1002388282 5:178887899-178887921 TTTTCTGGCAGGGGCAGGGGTGG - Intronic
1002597229 5:180332153-180332175 TTGTGCGGCAGGAACTGGGGAGG - Intronic
1002904578 6:1438328-1438350 TTGAAAGGCAGGAGCTGGGTGGG - Intergenic
1003074140 6:2968910-2968932 TGTTCTGGAAGGAGATGGGGTGG + Intronic
1003193268 6:3892591-3892613 CTTGCAGCCAGGGGCTGGGGGGG + Intergenic
1004126934 6:12883135-12883157 CCCTCAGGCAGGGGCTGGGGTGG - Intronic
1004251202 6:14024539-14024561 CCTGCAGGCAGGAGCTGGGCAGG - Intergenic
1006422905 6:33946584-33946606 CTTTCAGGCAGGAGCTGTTGGGG - Intergenic
1006850466 6:37094330-37094352 TGTTCTGGCAGGAGGTGGTGTGG + Intergenic
1007001817 6:38320499-38320521 CTTTCAAGCAGAAGCTGGGAAGG - Intronic
1007362335 6:41367917-41367939 ATCTCAGGCAGGAGAAGGGGAGG + Intergenic
1009242175 6:61196664-61196686 ATTACAGGCATGAGCTGGGAGGG + Intergenic
1010403882 6:75480495-75480517 TTTTGAGCCAGGAGCAGTGGAGG - Intronic
1011377021 6:86699541-86699563 TTTGTAGGCAGAACCTGGGGAGG + Intergenic
1013115592 6:107101561-107101583 TTTTCAGGTAGGAGATGGCTTGG - Intronic
1013120316 6:107135025-107135047 TTTTCAGGTAGGAGATGGCTTGG + Intergenic
1016886464 6:148964219-148964241 TTATCATGCAGGAAGTGGGGAGG - Intronic
1017327405 6:153155094-153155116 TTTTGAGGCAGGGGCAGCGGGGG + Intergenic
1017716450 6:157217025-157217047 TTCTGAGGGAGGAGTTGGGGCGG + Intergenic
1017722535 6:157253873-157253895 TTTCCAGGCAGGCTCTGGGAGGG - Intergenic
1018729684 6:166639395-166639417 TTTTCTGGCAAGAGCTAAGGAGG - Intronic
1021798711 7:24283986-24284008 TCTTCAGGCAGTGCCTGGGGCGG + Intergenic
1022639810 7:32171065-32171087 GTGTCAGTCAGGAGGTGGGGTGG - Intronic
1023873093 7:44273245-44273267 TGAACAGGCAGGGGCTGGGGAGG - Intronic
1023929124 7:44694191-44694213 TTCCCAGGCAGGAGCTGTGGTGG + Intronic
1024201861 7:47116547-47116569 AATGCGGGCAGGAGCTGGGGAGG - Intergenic
1024301433 7:47890243-47890265 CTTTCAGGCAGGTGCTGTGATGG + Intronic
1024557717 7:50617723-50617745 TGCTCAGAAAGGAGCTGGGGAGG + Intronic
1026045266 7:66902451-66902473 TTGCGAGGCAGGAGCTGGGCCGG - Intergenic
1026093800 7:67324391-67324413 TGTTCAGGCAGAAGCAGAGGAGG + Intergenic
1027202237 7:76071606-76071628 TTGCGAGGCAGGAGCTGGGCCGG + Intergenic
1027202533 7:76072754-76072776 TTGCGAGGCAGGAGCTGGGCCGG + Intergenic
1027748568 7:82110661-82110683 TCTTCAGGCAGGAGCATGGTGGG - Intronic
1028948098 7:96603521-96603543 TTCTCAGGGAGGAGGTTGGGTGG - Intronic
1029091387 7:98051154-98051176 TTAAAAGGCAGGAACTGGGGAGG - Intergenic
1029212867 7:98923041-98923063 TCATAAGGCAGGAGTTGGGGAGG - Intronic
1033655207 7:143368623-143368645 TTCAGAGGCAGAAGCTGGGGAGG - Intergenic
1035118662 7:156546681-156546703 TTTTTTGGCAGGGGGTGGGGCGG - Intergenic
1035237320 7:157507111-157507133 GTGGCAGCCAGGAGCTGGGGTGG - Intergenic
1035654624 8:1296124-1296146 TTTGCAGGGTGGAGTTGGGGTGG + Intergenic
1036051012 8:5196823-5196845 TTTTAAGAAAGGAGTTGGGGAGG - Intergenic
1037374769 8:18216000-18216022 TTTTCATGTAAGAGCTGGGTAGG + Intronic
1039161330 8:34625118-34625140 TTTTCGGGCATGAGATGAGGTGG - Intergenic
1040566593 8:48573094-48573116 CTTCCAGGCAGGAGATGGGGTGG - Intergenic
1040575199 8:48645864-48645886 TTTTCAGGCATGTGCTGGGCTGG + Intergenic
1044344631 8:91091186-91091208 TTTTGAGTCAGGAGGAGGGGAGG - Intergenic
1045199322 8:99963282-99963304 TTTGCAGGGAGGAGGTGAGGTGG + Intronic
1045501874 8:102749746-102749768 GTGTGAGGCTGGAGCTGGGGTGG - Intergenic
1045779522 8:105847550-105847572 TTCTCAGACAGCAGCTGGGAAGG - Intergenic
1047130954 8:122018788-122018810 TTTGCAGGCAGGAGGTGGTGGGG + Intergenic
1047202884 8:122781506-122781528 TTTTCAGGCAGGAGCTGGGGGGG - Exonic
1047889556 8:129292797-129292819 CCTTCAGGCAGGAGGTGGTGTGG - Intergenic
1048681138 8:136843002-136843024 TTTTCAGGGAGCAGCAGGGATGG - Intergenic
1049442989 8:142617635-142617657 TGATCAGGCAGGAGCAGAGGCGG - Intergenic
1049542060 8:143213145-143213167 GTTTGAGGCTGGAGCTGGTGGGG + Intergenic
1049891554 9:74317-74339 TTCTAAGGCAGGAGCTGGGTAGG - Intergenic
1052849523 9:33368431-33368453 TTCTCAGACAGGAGCAGGGAAGG + Intronic
1053163934 9:35831481-35831503 TTTGAAGGAAGGAGCTGTGGAGG + Intronic
1053732984 9:41075411-41075433 TTCTAAGGCAGGAGCTGGGTAGG - Intergenic
1054695439 9:68356147-68356169 TTCTAAGGCAGGAGCTGGGTAGG + Intronic
1056487519 9:87073743-87073765 TTTCCAGACAGGAGCAGGGCTGG + Intergenic
1056983606 9:91340729-91340751 TTTGCAGGAAGAAGCTGGAGAGG - Intronic
1057598924 9:96440283-96440305 TTTGTAGGTAGGAACTGGGGTGG + Intergenic
1057826954 9:98378694-98378716 TGTGCATGCAGGAGCTGGGATGG + Intronic
1058454783 9:105128995-105129017 TTTTCAGGCTGGGGCTTGTGTGG - Intergenic
1059226148 9:112674953-112674975 TTTCTAGGAAGCAGCTGGGGAGG - Intergenic
1060218320 9:121751607-121751629 TTGTCAGGAAGTAGCTGGGGAGG + Intronic
1060269823 9:122132495-122132517 ATCTCAGGCTGGAGCTGGGGAGG + Intergenic
1060422606 9:123480163-123480185 TGTCCAGGCAGAAGATGGGGAGG - Intronic
1060435139 9:123586536-123586558 GCTCCAGGCAGGAGCTGGGACGG + Intronic
1060985822 9:127818425-127818447 TTTGAAGGCAGCAGGTGGGGTGG - Intronic
1061022659 9:128026333-128026355 TGTGCAGGCAGGAGCTGCTGTGG + Intergenic
1062248936 9:135584485-135584507 TTTCCAGCCTGGAGCTGGGCTGG + Intergenic
1186504922 X:10083452-10083474 TGGTCAGGCATGAGGTGGGGTGG - Intronic
1186505150 X:10085781-10085803 GCTCCAGGCAGGAGCTGGAGAGG - Intronic
1188211537 X:27430846-27430868 GTTTCAGTCAGGAGTTGGGAAGG - Intergenic
1189148102 X:38675773-38675795 CGTTCATGCAGCAGCTGGGGGGG - Exonic
1189520383 X:41760901-41760923 TTTGCAGGTAGAAGCTGGGATGG + Intronic
1190114640 X:47618787-47618809 CTTTAAGGACGGAGCTGGGGTGG + Intronic
1190581383 X:51894993-51895015 CTCTGAGGCAGGAGGTGGGGTGG - Intronic
1192413223 X:70953626-70953648 TTCTCCTGCTGGAGCTGGGGTGG - Intergenic
1192608689 X:72545927-72545949 TATAAAGGCTGGAGCTGGGGTGG + Intronic
1192706870 X:73535487-73535509 TTTTCTGGCTGGAACTGTGGAGG + Intergenic
1192844433 X:74891141-74891163 TTTTAAGGAAGGAGCGGGGCTGG - Intronic
1192951928 X:76026417-76026439 TTTCCCTGCTGGAGCTGGGGAGG + Intergenic
1199381969 X:147181920-147181942 TTTTGAGGCTGGAGTTGGGGAGG - Intergenic
1202367307 Y:24174176-24174198 TGGGCAGGCAGGAGCAGGGGAGG + Intergenic
1202503474 Y:25495947-25495969 TGGGCAGGCAGGAGCAGGGGAGG - Intergenic