ID: 1047202885

View in Genome Browser
Species Human (GRCh38)
Location 8:122781507-122781529
Sequence TTTTTCAGGCAGGAGCTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 323}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202885_1047202894 3 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202885_1047202893 0 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202885_1047202895 4 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202885_1047202897 6 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202885_1047202892 -9 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202885_1047202896 5 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202885 Original CRISPR TTTTTCAGGCAGGAGCTGGG GGG (reversed) Exonic
900878059 1:5360110-5360132 ATTTACAGCCAGGAGCAGGGTGG + Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903345936 1:22684402-22684424 TTTTGCAAGCAGGAGGTTGGTGG + Intergenic
903576138 1:24340925-24340947 TTTCTCAGGTGCGAGCTGGGCGG + Intronic
904176971 1:28636941-28636963 TTTTCCAGGCTGGAGCATGGTGG - Intronic
904318174 1:29679560-29679582 TTTTCCAGCCAGGAGCTGGTCGG + Intergenic
904634632 1:31870316-31870338 TTGTTCAGGCTGGAGTTGAGTGG - Intergenic
905402480 1:37713768-37713790 TCGTGCAGGCAGGAGCTGAGGGG + Intergenic
909102152 1:71361669-71361691 ATATTCAGGCAAAAGCTGGGTGG - Intergenic
911045939 1:93628405-93628427 TTTTTCTGGAATGAGATGGGAGG - Intronic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
911725379 1:101236852-101236874 TTCTTCAGGAAGAGGCTGGGAGG - Intergenic
912088588 1:106041693-106041715 TTTTTCATGCAGCAGTTTGGGGG - Intergenic
912273294 1:108231320-108231342 TTTTTCAGGCACCAGGTTGGGGG + Intronic
912294926 1:108463002-108463024 TTTTTCAGGCACCAGGTTGGGGG - Intronic
913280614 1:117181715-117181737 GGTTTGAGACAGGAGCTGGGAGG + Intronic
915724060 1:158005317-158005339 GTTTTCAGGAAGCAGCTGGTGGG + Intronic
916226161 1:162491469-162491491 CTTTTCAGGCAAGAGCTAGCTGG + Intergenic
917729274 1:177858122-177858144 TATGTCAGGCAGCAGCTGGCAGG - Intergenic
918208864 1:182333299-182333321 TTTCTGGGGCAGGAGCAGGGAGG - Intergenic
918555428 1:185793709-185793731 TTTTTAAAACAGGAGATGGGAGG + Intronic
919381022 1:196861479-196861501 TATTTCAGGCATCTGCTGGGGGG - Intronic
919817305 1:201449473-201449495 TTTTTCAGGCAGGCAATGGCAGG - Intergenic
921164678 1:212498236-212498258 TTTTTCAGTTACTAGCTGGGTGG + Intergenic
921481642 1:215670906-215670928 TTTTACAGGCAGGTGCTGACGGG + Intronic
922375294 1:224957914-224957936 TATTTGAGGCAGGAGCTGCTTGG + Intronic
923437874 1:233984998-233985020 ATTTTCATGCAGGGGTTGGGGGG + Intronic
924548373 1:245051432-245051454 TTTTGCAGCCAGAAGCTTGGGGG + Intronic
1064030484 10:11879947-11879969 TGTTTCTGGTAGGAGCTGGTTGG - Intergenic
1064641221 10:17417676-17417698 TTTGGCAGCCTGGAGCTGGGTGG - Intronic
1068509995 10:57953639-57953661 TTTTTCAAGCATTAGCTAGGTGG - Intergenic
1068615706 10:59113612-59113634 TTTTTTAGGCAAGACCTGAGAGG + Intergenic
1069051744 10:63802577-63802599 TTTTACAGGGAGGAGTTGGGAGG + Intergenic
1071842286 10:89485007-89485029 TGAGTCAGGCTGGAGCTGGGAGG + Intronic
1073417722 10:103398194-103398216 TTTTTCTGGAAGAAGGTGGGTGG + Intronic
1073635959 10:105199398-105199420 TTTTTAAGGAAGGAGGAGGGAGG + Intronic
1074980938 10:118619624-118619646 TTCTTCAGGCAGGAGTCTGGAGG + Intergenic
1075119578 10:119654765-119654787 TTATTCAGGGAGGAGCCTGGAGG - Intronic
1075849115 10:125573420-125573442 TTTTTAACTCAGCAGCTGGGAGG + Intergenic
1077506940 11:2933948-2933970 TTCCTCAGGCTGCAGCTGGGAGG - Intergenic
1078253013 11:9633496-9633518 TATTTCAGGAAGAAACTGGGTGG + Intergenic
1078728997 11:13959084-13959106 TTAATCAGGCAGGAGGAGGGAGG + Intergenic
1079622079 11:22567276-22567298 GTGTTCAGGCAGGGGCAGGGTGG + Intergenic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1081208886 11:40307435-40307457 TTTGCAAGGCAGAAGCTGGGTGG - Intronic
1082197783 11:49325105-49325127 TTTTTAAGTCAGGAGCTGACTGG + Intergenic
1082725752 11:56734312-56734334 TTTTTTTCGCAGGGGCTGGGGGG + Intergenic
1082939537 11:58689545-58689567 TTTTACAGCCAAGAGCAGGGTGG + Intronic
1085416917 11:76324768-76324790 TGCTTCAGGCAGGAGATTGGAGG + Intergenic
1085472517 11:76767366-76767388 GTTTTCAAGCAGAAGCTGGGTGG + Intergenic
1086224662 11:84493459-84493481 TGATTCAGGCAGGGGCTGGTTGG - Intronic
1086490929 11:87357132-87357154 TCTGTCAGGAAAGAGCTGGGTGG - Intergenic
1089059092 11:115611548-115611570 TTTTTCAGGCTGGGGCTGGGTGG + Intergenic
1089491406 11:118886463-118886485 TCTTTAAGGCAGGGGCTGGGGGG + Intronic
1089620803 11:119721189-119721211 CTTCTCCGGGAGGAGCTGGGTGG - Intronic
1090401806 11:126453887-126453909 TATACCAAGCAGGAGCTGGGAGG - Intronic
1090404066 11:126466809-126466831 TTTCTGAAGCAGGAGGTGGGAGG - Intronic
1090477670 11:127038166-127038188 TGTGTCAGGTAGGGGCTGGGGGG + Intergenic
1091622046 12:2096420-2096442 TCCTTCAGGAAGGAGATGGGAGG - Intronic
1094181497 12:27596967-27596989 TCTTCCAGGGAGGAGGTGGGTGG - Intronic
1096226220 12:49868428-49868450 TCTTCCAGACAAGAGCTGGGAGG - Exonic
1097152054 12:56986431-56986453 TATTGGAGGCAGGAGCTGGTGGG + Intergenic
1097167640 12:57094154-57094176 TTCTTGAGGGAGGAGCTCGGAGG + Intronic
1097584692 12:61501384-61501406 TTTTTCAGAGAGAAGTTGGGGGG + Intergenic
1098305185 12:69095634-69095656 TTTTTGAGGCAGGAAACGGGAGG + Intergenic
1099292452 12:80788660-80788682 TTTGGCGGGCAGGAGTTGGGGGG + Intergenic
1100464300 12:94831768-94831790 TTACTAAGGCAGGAGCTAGGTGG - Intergenic
1100557972 12:95716641-95716663 ATTGTAAGGCATGAGCTGGGGGG - Intronic
1103253555 12:119521737-119521759 TGATTCAGGGAGGAGGTGGGAGG - Intronic
1104387983 12:128367188-128367210 TGTTCAAGGCAGGAGCTTGGAGG + Intronic
1104660423 12:130608113-130608135 GTTCCCAGGCAGGGGCTGGGAGG - Intronic
1106430964 13:29680234-29680256 TTTTTTTGGCAGGGGCTGGGGGG + Intergenic
1106466929 13:30021792-30021814 CATTTCAGGCTGGAGCTGGGAGG - Intergenic
1110947370 13:81439788-81439810 TCTTACAGGCAGGAGATCGGAGG - Intergenic
1111557222 13:89896301-89896323 TTGTAAAGGCAGGAACTGGGAGG - Intergenic
1111657958 13:91175587-91175609 TGTTTCAGGGAGCATCTGGGAGG - Intergenic
1112125458 13:96462073-96462095 TTTTTCAGGCAGGGTCTGACAGG + Intronic
1112501479 13:99946598-99946620 TTTTACAGGCAAGAGATGTGGGG - Intergenic
1113494413 13:110715563-110715585 TTTTTCGGGGAGGAGCGGGGTGG + Exonic
1113601460 13:111572183-111572205 TATATCAGGAAGGAGCTGGAGGG + Intergenic
1114435204 14:22700458-22700480 TTTTTTAGGCAAGTCCTGGGTGG - Intergenic
1114678071 14:24458887-24458909 TGTTTCAGGAAGCAGCTGTGAGG - Intergenic
1115274486 14:31592292-31592314 TTTGGGAGGCAGGAGGTGGGTGG + Intronic
1116099828 14:40419643-40419665 TTTTTCAGTCAGCAGGAGGGGGG + Intergenic
1116340338 14:43714762-43714784 TTTTTCAGGCTGTACCTGTGCGG + Intergenic
1116866511 14:50035982-50036004 TTTTTGAGGCAGGGGCAGAGGGG + Intergenic
1117620707 14:57583467-57583489 TTCTTCAACCAAGAGCTGGGAGG + Intronic
1118425871 14:65661146-65661168 TTTCTTAGGGAGGAGCTGGAAGG + Intronic
1120283615 14:82469688-82469710 TTTTGCAGGGAGGACATGGGTGG + Intergenic
1120912531 14:89680580-89680602 TTTTTCTGGCTGGGGCTGGAAGG - Intergenic
1121100114 14:91244708-91244730 ATTTTCTAGCCGGAGCTGGGAGG - Intronic
1121234762 14:92384122-92384144 TATTTCATGCTTGAGCTGGGGGG - Intronic
1121622003 14:95356700-95356722 TCTCTGAGGCAAGAGCTGGGAGG - Intergenic
1121885306 14:97537520-97537542 CTCTGCAGGCAGGAGCTGGCAGG - Intergenic
1121932272 14:97983160-97983182 GTTTTCTGGCAGGGGGTGGGAGG + Intergenic
1122350136 14:101084250-101084272 TTGTGCAGGCAGGTGCTGAGAGG + Intergenic
1122962815 14:105105425-105105447 TTTGCCTGCCAGGAGCTGGGAGG + Intergenic
1122972813 14:105159236-105159258 TTCTGCAGGCAGGGGCTCGGGGG - Intronic
1123474748 15:20581843-20581865 TTTTGCAGGCAGCAGCTGCCAGG - Intergenic
1123643263 15:22418514-22418536 TTTTGCAGGCAGCAGCTGCCAGG + Intergenic
1124439702 15:29677070-29677092 CTTTGCAGGCAAGAGCTGGGAGG - Intergenic
1126743025 15:51797323-51797345 TTTTCCTGGAAGGTGCTGGGAGG + Intronic
1128709332 15:69860043-69860065 AATTTCAGGCAGCAGCTGGCAGG - Intergenic
1129771192 15:78204514-78204536 CTGTCCAGGCAGGGGCTGGGTGG + Intronic
1130442810 15:83972681-83972703 TTTGGCAGGCAGGAGTGGGGTGG - Intronic
1132175200 15:99708636-99708658 TTTATCAGGCAGCTGCTGTGTGG + Intronic
1132525424 16:411798-411820 CATTTCTGGCAGGTGCTGGGTGG + Intronic
1132534509 16:471397-471419 GTTTTCACCCAGGAGCTTGGGGG + Intronic
1132747035 16:1441077-1441099 TTGTTCAGGCTGGAGCGTGGTGG - Intronic
1134074462 16:11280951-11280973 ATTCTCAGGCAGGAGTTTGGTGG + Exonic
1134841030 16:17401786-17401808 TTTTTTAAGCAGGAGCTGACTGG - Intronic
1135269140 16:21053864-21053886 TTTTTAAAGGAGGAGCTGGAAGG + Intronic
1135556054 16:23437459-23437481 ATTCTAAGGCTGGAGCTGGGGGG - Intronic
1136023946 16:27458038-27458060 TTTTTCAGGGAGGGGCTGAATGG - Intergenic
1137578391 16:49618963-49618985 ACTTTGAGGCAGGAGGTGGGTGG - Intronic
1138411978 16:56847729-56847751 TTTTTCACTCACGAGCTGGGCGG + Intronic
1138539034 16:57677219-57677241 TTTCTGAGGCAGGCCCTGGGTGG + Intronic
1139061950 16:63263596-63263618 GTGTTCAGGCAGGGGCAGGGTGG + Intergenic
1139959047 16:70707263-70707285 TTTTTAAGGCATGAGTTGGCAGG - Intronic
1141067468 16:80925680-80925702 TTCTTCAGGCAGGAGCGGGCTGG + Intergenic
1141471980 16:84245016-84245038 TTCTGCAAGCAGGTGCTGGGTGG - Intergenic
1141509194 16:84501641-84501663 TTTTTCAAGCAGGAGAGAGGAGG + Intronic
1142134841 16:88447043-88447065 GTTTTCAGCCACGAGCTTGGGGG - Intergenic
1142733949 17:1882785-1882807 ATTCTCAGGCAGCAGCTGCGTGG - Intronic
1143002792 17:3805625-3805647 TTTCTAAGGAAGGGGCTGGGAGG + Intergenic
1143635053 17:8159686-8159708 GATTTCAGGCAGGAATTGGGGGG + Exonic
1144457392 17:15430301-15430323 TGCTTCAGGGAGGAGATGGGTGG + Intergenic
1144831066 17:18131491-18131513 TTTCTCAAGCAGGTACTGGGAGG - Exonic
1146320435 17:31842462-31842484 GGATTCAGGCAGGTGCTGGGAGG + Intergenic
1146823400 17:36002510-36002532 TTATTCAGACATGAGCAGGGCGG - Intergenic
1146828643 17:36047341-36047363 TGTTTCAGGTAGGACCTGAGTGG - Intergenic
1146896580 17:36545611-36545633 TGTTGCAGGCAGGAGCTGGGAGG + Exonic
1148517942 17:48239435-48239457 TTTTTATAGCAGGAGCTGTGAGG - Intronic
1148817549 17:50340858-50340880 ATTTTTTGGCAGGAGATGGGAGG + Intergenic
1149003713 17:51782960-51782982 TTTTTCTGGAAGGAGATTGGTGG - Intronic
1149602682 17:57903455-57903477 ACTTTCAGGAAGGAGCTAGGAGG + Intronic
1150139776 17:62717840-62717862 TGTATCAGCCAGGATCTGGGTGG - Intronic
1150249819 17:63699412-63699434 GTTGACAGGCAGGGGCTGGGGGG + Intronic
1151186626 17:72369503-72369525 TTTTTCCAGGAGGAGCTGGAAGG + Intergenic
1151390967 17:73786405-73786427 TTTTGGAGGCTGGCGCTGGGCGG + Intergenic
1151407637 17:73899779-73899801 TTTTTAAAGAGGGAGCTGGGCGG - Intergenic
1151533066 17:74720092-74720114 TTTTGCAGGTAGGAACTGGAGGG + Intronic
1151879325 17:76885622-76885644 TTTCCCAGGAGGGAGCTGGGAGG - Intronic
1151965642 17:77429889-77429911 TTTGACAGCCATGAGCTGGGAGG - Intronic
1153584877 18:6610967-6610989 TTTTTCAGGGAAGAGCTTTGTGG + Intergenic
1153773713 18:8435068-8435090 TTTTACAGGCACAAGTTGGGGGG - Intergenic
1155114408 18:22750389-22750411 TTCTTCAGGAAGGAGCAGGTTGG + Intergenic
1155175691 18:23299379-23299401 ATCTTCAGGCAGAAGTTGGGTGG - Intronic
1155302789 18:24447277-24447299 TTTTTATGGCCAGAGCTGGGAGG + Intronic
1155419707 18:25641873-25641895 TATTTCAGGTAGGACCTGGTTGG + Intergenic
1156704013 18:39858093-39858115 TTTGTCAGCCACGAGTTGGGTGG - Intergenic
1157112895 18:44837656-44837678 TGCTGCAGGAAGGAGCTGGGAGG + Intronic
1157542164 18:48518780-48518802 ATTTTAAGGAAGGAGTTGGGAGG + Intergenic
1157984141 18:52418410-52418432 TTTTTGAGGCTGGAGCAGGCAGG + Intronic
1159004417 18:62999861-62999883 TATTAGAGGCAGGAGCTTGGTGG + Intergenic
1159923062 18:74243667-74243689 TGTTTCTGGCATGACCTGGGTGG + Intergenic
1160681976 19:416020-416042 TGTTTGTGGGAGGAGCTGGGGGG + Intergenic
1161216446 19:3097144-3097166 TTTTTCAGGGAGCAGCTAGAGGG + Intronic
1162304556 19:9863991-9864013 GTACTCAGGTAGGAGCTGGGTGG + Intronic
1162478525 19:10915067-10915089 TTGTGCAGGCAGGGGCAGGGGGG + Intronic
1163262927 19:16202020-16202042 TTTGTGAGGAAGGACCTGGGGGG + Intronic
1163443593 19:17333996-17334018 TTTGTAAGGGAGGATCTGGGGGG - Intronic
1163673957 19:18646020-18646042 TCTTCCTAGCAGGAGCTGGGGGG - Intronic
1164131741 19:22369317-22369339 TTTTTGAGGCGGGAGGAGGGCGG - Intergenic
1164575180 19:29401676-29401698 TTTGTCACGCAGGATATGGGGGG - Intergenic
1165232011 19:34393179-34393201 GGTTTCCGGCAGGAGGTGGGGGG + Intronic
1165361059 19:35337354-35337376 GCTTTGAGGCAGCAGCTGGGTGG + Intronic
1165999265 19:39868336-39868358 TCTTTCAGGCAGGAGTGCGGTGG - Intronic
926306036 2:11637795-11637817 CTTCTCCAGCAGGAGCTGGGCGG - Exonic
926704300 2:15825966-15825988 TGTTACAGGCAGGAGCTGCGAGG + Intergenic
927090415 2:19706516-19706538 TTTTTCAGACAGGCACAGGGAGG + Intergenic
928088603 2:28360567-28360589 TGTTTCAGGCAGGAGGTGGGAGG + Intergenic
929172187 2:38943301-38943323 CTCTTCAGGCAGGAGATTGGAGG - Intronic
929216197 2:39416155-39416177 ATTTTCAGTCAGATGCTGGGAGG + Intronic
930137655 2:47918545-47918567 GATTACAGGCAGGAGCTGTGAGG - Intergenic
931617750 2:64177721-64177743 ACTTTCAGGAATGAGCTGGGAGG - Intergenic
931692531 2:64847449-64847471 TGTTCCAGGCAGGAGGAGGGAGG + Intergenic
932305945 2:70704437-70704459 TCTTTCAGGGAGGAGCTGGAAGG - Exonic
932766825 2:74475712-74475734 CTCTTCAGGCAGGAGCTGTAGGG + Exonic
936404209 2:112187766-112187788 TTTTTCATCCAGGGGATGGGTGG + Exonic
936520314 2:113207925-113207947 TTTTTCAGGCAGGAGTGCAGTGG + Intronic
937072939 2:119078361-119078383 TTTTGAAGGCAGGATCTGGATGG - Intergenic
937701053 2:124863375-124863397 TTGTGCAGACAGGAGCTGGTAGG - Intronic
938129096 2:128695268-128695290 TTTTTCAGGCAAGAAATGTGAGG - Intergenic
939028583 2:137043586-137043608 TTTTTGAGGCAGGAGGTGTGTGG + Intronic
947147276 2:227079925-227079947 TTTTTCAGACATGCGTTGGGTGG - Intronic
1169282973 20:4282770-4282792 TATTCCAGGCAGGAGATGGGAGG + Intergenic
1170586539 20:17739075-17739097 TTTCTAAGACAGGAGCTGGATGG + Intergenic
1170620487 20:17991612-17991634 ATATTCAGGTAGGAGATGGGAGG + Intronic
1171421262 20:25019266-25019288 TCTTTCGGGCTGGTGCTGGGAGG - Intronic
1172038832 20:32029634-32029656 CCTTTCAGGCAGGGGTTGGGTGG + Intronic
1172860537 20:38046744-38046766 TTGTTGAGGCAGGAGGTTGGAGG + Intronic
1174034783 20:47661974-47661996 TATTTCAGGCAGGTGGCGGGTGG + Intronic
1174561964 20:51437569-51437591 TTTTTCATGGGGGAGGTGGGTGG - Intronic
1174993188 20:55536004-55536026 TATTTCAAGAAGGAGCTTGGTGG - Intergenic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1175916852 20:62430037-62430059 CTGATCAGCCAGGAGCTGGGGGG + Intergenic
1177229584 21:18302328-18302350 TTTTACAGGCAGAGGCTTGGTGG + Intronic
1177597104 21:23258633-23258655 TTTTTCAGGTAGGCACTTGGGGG + Intergenic
1179816353 21:43908776-43908798 TTTTGCAGCCTGGAGCTGGCAGG - Intronic
1180101887 21:45591215-45591237 TTTCTCGGGCAGGGCCTGGGAGG - Intergenic
1182792848 22:32967404-32967426 TCCCTCAGGAAGGAGCTGGGAGG - Intronic
1183085996 22:35487509-35487531 TTTGCCTGGCAGGAGCTGTGCGG - Intergenic
1183342185 22:37287555-37287577 CTCTTCCGGCAGGAGCTGGCGGG - Intronic
1183364255 22:37398940-37398962 TGTTCCAGGAAGGAGCTGGTAGG - Intronic
1184011952 22:41755620-41755642 TGTTTAAGGCAGGAGATGTGTGG - Intronic
1184652264 22:45924790-45924812 CTCATCAGGCAGGTGCTGGGGGG + Intronic
1184652332 22:45925007-45925029 CTCATCAGGCAGGTGCTGGGTGG + Intronic
1184751805 22:46490577-46490599 CTTTTCAAGCAGGACCTGGGAGG + Intronic
1185244337 22:49765277-49765299 TCTCAGAGGCAGGAGCTGGGGGG + Intergenic
949414848 3:3802456-3802478 TTTTTCTGGCGGGGGTTGGGGGG - Intronic
949420950 3:3865039-3865061 GTTTCCAAGCAGGAGCTGGGAGG - Intronic
950148678 3:10669438-10669460 GCGTTCAGGGAGGAGCTGGGAGG - Intronic
950965311 3:17141987-17142009 ATTTGCAGGAAGGAGCAGGGAGG - Intergenic
952088403 3:29854157-29854179 CTTCTCAGCCTGGAGCTGGGAGG - Intronic
952857744 3:37785995-37786017 TTGTTCTTGCAGGAGCAGGGGGG + Intronic
954073116 3:48157749-48157771 TTTCTCAGGAGGGAGCTTGGTGG - Exonic
954774672 3:53006050-53006072 TTCTTCAGGCAGCAGCTTGAAGG - Intronic
954788692 3:53114528-53114550 TTCTGCAGGCAGGGGCTGAGTGG + Intronic
957877941 3:86173737-86173759 TTTCACAGGCAGGAGCAGGAAGG - Intergenic
958102987 3:89037183-89037205 TTTTGCAGGTAAGGGCTGGGTGG - Intergenic
960988879 3:123297597-123297619 GGTTTCAGGTAAGAGCTGGGTGG - Intronic
961074227 3:123966565-123966587 TATTTCAGGCTGGGGGTGGGAGG + Intergenic
961309400 3:125985565-125985587 TATTTCAGGCTGGGGGTGGGAGG - Intergenic
961783231 3:129333889-129333911 TCTCCCAGGCAGGAGCTAGGGGG - Intergenic
962098570 3:132317422-132317444 TGTTTCTGGCAGGAGTTAGGAGG - Exonic
962614284 3:137109268-137109290 TTTAGCTGGCTGGAGCTGGGAGG + Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
967709387 3:192687693-192687715 TGGTGGAGGCAGGAGCTGGGGGG - Intronic
968202044 3:196763064-196763086 TTTCCCAGGCAGGGGGTGGGGGG - Intronic
968661735 4:1801471-1801493 TTCTTCAGCCAGGAGATGGAGGG - Exonic
969310864 4:6352383-6352405 TTTTTCAAGCAGGATTTAGGCGG - Intronic
969373378 4:6747959-6747981 TTTCTCTGCCAGGAGTTGGGTGG - Intergenic
969675077 4:8610118-8610140 TTCCTGGGGCAGGAGCTGGGTGG + Intronic
970566417 4:17336301-17336323 TTTTTCAGGGTAGAGATGGGTGG - Intergenic
971353549 4:25873763-25873785 CTTTTAGGCCAGGAGCTGGGAGG - Intronic
973329402 4:48897099-48897121 TGTTGCAGGGAGGAGGTGGGGGG - Intronic
973576613 4:52296245-52296267 TTGTCCAGGGAGGAGATGGGTGG + Intergenic
974115585 4:57575572-57575594 TTTTTCCAGCAGGAAGTGGGAGG + Intergenic
974483493 4:62475931-62475953 TATTTCAGGGTGGAACTGGGGGG + Intergenic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
979016237 4:115437278-115437300 TTTCTCAGCCAGGACCTGGAGGG + Intergenic
979878750 4:125928207-125928229 TTTTGGAGCCATGAGCTGGGAGG - Intergenic
980572590 4:134639974-134639996 TTTTTTTGGCAGGGGGTGGGTGG + Intergenic
980802286 4:137767753-137767775 ATTATCAGGCAGTAGCTGGATGG + Intergenic
981714724 4:147741542-147741564 ATTTTCAGGCAGGGACTGGATGG + Intronic
982032519 4:151314877-151314899 TGTTCCTGGCAGGAGGTGGGAGG + Intronic
982746069 4:159104297-159104319 TGTGTCAGGAAGGAGGTGGGGGG - Intronic
983871878 4:172832921-172832943 TTTTTCTAGCTGGAGCTGGTGGG - Intronic
984766431 4:183403977-183403999 CTTCTCAGGCTGGGGCTGGGTGG - Intergenic
985748930 5:1663542-1663564 TGTGAGAGGCAGGAGCTGGGAGG + Intergenic
985757355 5:1726874-1726896 GTGTTCAGGCTTGAGCTGGGTGG + Intergenic
989148333 5:38271189-38271211 TTTTTCAGGCATCAGCTGCATGG + Intronic
991245134 5:64502584-64502606 TATTTCTTGCAGGAGCTGGGGGG - Intergenic
991653903 5:68883667-68883689 TCTTTCAGGGAGAAGGTGGGAGG - Intergenic
992168240 5:74076174-74076196 CTTTTAATGCAGGAGGTGGGGGG - Intergenic
992614430 5:78535279-78535301 TTGCTCAGGGAGGAGGTGGGTGG - Intronic
993101314 5:83543315-83543337 TTTTGCAGGTAGCAGCTAGGTGG - Intronic
994559526 5:101349490-101349512 CTTTACAGGCAGCAGATGGGTGG - Intergenic
995486029 5:112640952-112640974 TCTTCCAGGCAGCAGCTGGTGGG - Intergenic
995992119 5:118253238-118253260 TTTTTTAGGCAGTTGCTGAGGGG - Intergenic
996400179 5:123053864-123053886 TTTTTCAGGGTGGATCTGTGAGG - Intergenic
996441598 5:123497643-123497665 TTTTCCAGGCTGGAGTTCGGCGG + Intergenic
998452678 5:142246823-142246845 GTTTTCTGGCAGGGACTGGGTGG - Intergenic
1000132259 5:158310914-158310936 TTTTTTTGGCGGGGGCTGGGGGG - Intergenic
1000869772 5:166561488-166561510 TTTTTGAGGCAGGAAGTGGTTGG + Intergenic
1001446656 5:171790474-171790496 TGTTTCAGGAAGCAGTTGGGAGG + Exonic
1001706658 5:173745965-173745987 TTCTTCAGGAAGGAAATGGGTGG - Intergenic
1002511652 5:179723652-179723674 TTTTTCAGCCAGGCGTTGTGGGG + Exonic
1002904579 6:1438329-1438351 TTTGAAAGGCAGGAGCTGGGTGG - Intergenic
1003039955 6:2678540-2678562 TTGTTCAGTTAGGAGTTGGGTGG - Intronic
1003193267 6:3892590-3892612 TCTTGCAGCCAGGGGCTGGGGGG + Intergenic
1004459114 6:15819443-15819465 TGTTGCAGGCAGGCGGTGGGAGG + Intergenic
1004660506 6:17706010-17706032 TTTCCCAGGCAGGCTCTGGGCGG - Intronic
1005078036 6:21927676-21927698 CTTTTCAGGCCGGAGCGGGCAGG + Intergenic
1006374901 6:33666705-33666727 TTTTAAAGGCTGGGGCTGGGTGG - Intronic
1006422906 6:33946585-33946607 GCTTTCAGGCAGGAGCTGTTGGG - Intergenic
1006474950 6:34247621-34247643 TTGCTAAGGCAGGGGCTGGGTGG - Intronic
1006618907 6:35348715-35348737 TCTTTCAGGAAGGTCCTGGGTGG + Intronic
1009242174 6:61196663-61196685 GATTACAGGCATGAGCTGGGAGG + Intergenic
1009560121 6:65229667-65229689 TTTCTAAGACTGGAGCTGGGTGG + Intronic
1010863086 6:80937677-80937699 TTTCTCAGCCAGGAGGTTGGTGG - Intergenic
1012659572 6:101871068-101871090 TTTGTCAGGCAGGAGCAGAAAGG + Intronic
1013866723 6:114707294-114707316 TTGTTCAGACAGAAGCTCGGAGG + Intergenic
1015201135 6:130582679-130582701 TTTTTAATGTAGCAGCTGGGAGG + Intergenic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1017327404 6:153155093-153155115 TTTTTGAGGCAGGGGCAGCGGGG + Intergenic
1017515374 6:155151659-155151681 TTAATCAGGCAGCAGCTTGGAGG + Intronic
1017593063 6:155997624-155997646 TTTTGCAGGCAGAAGATGGAAGG + Intergenic
1017722536 6:157253874-157253896 CTTTCCAGGCAGGCTCTGGGAGG - Intergenic
1018387699 6:163319832-163319854 TTTTGCAAGCAAAAGCTGGGAGG + Intergenic
1019090541 6:169528407-169528429 TTTTTCAGGCAGGAAGTGAGTGG + Intronic
1019514618 7:1434268-1434290 TCCTGCAGGCAAGAGCTGGGAGG + Intronic
1020128315 7:5545523-5545545 TCTGTGAGGAAGGAGCTGGGTGG - Intronic
1020229331 7:6305584-6305606 TTTTCCAGGGAGGATCTTGGGGG + Intergenic
1021544969 7:21803584-21803606 TTTTTTGGGCAGGAGGTGTGGGG - Intronic
1024246789 7:47476845-47476867 TTGTTGAGAAAGGAGCTGGGAGG - Intronic
1024969367 7:55054414-55054436 TTGTTCAGACAGGAGTGGGGTGG + Intronic
1026866530 7:73827664-73827686 TTTTTCCCGCAGCAGGTGGGTGG + Intronic
1027748569 7:82110662-82110684 ATCTTCAGGCAGGAGCATGGTGG - Intronic
1029434161 7:100552734-100552756 TTGTCCCGGCAGGAGCTGGCAGG + Intronic
1029536642 7:101161181-101161203 TGGGTGAGGCAGGAGCTGGGAGG + Exonic
1030566336 7:111162928-111162950 TTTTTCAGGCAGGCGCTCTAAGG - Intronic
1031490431 7:122381143-122381165 GCTTTCAGCCAGGAGCTGGGGGG - Intronic
1032415202 7:131730162-131730184 GTTTTCTGGGAGGGGCTGGGGGG + Intergenic
1032935655 7:136728974-136728996 TTTCTCAGGCAGGAGTCTGGTGG + Intergenic
1032982566 7:137300786-137300808 TTTTTCGGGCTGAAGCAGGGTGG - Intronic
1034344003 7:150374730-150374752 TTTTTAAGGCAGGGGTGGGGAGG + Intronic
1034443464 7:151099934-151099956 TTTCTCAGCCAGGAAGTGGGCGG - Intronic
1034959609 7:155356982-155357004 TGATTCAGGCAGGCCCTGGGTGG + Exonic
1034965141 7:155386193-155386215 CTTCTCAGCCTGGAGCTGGGAGG - Intronic
1035472101 7:159117056-159117078 TTCTTCAGGGAGTTGCTGGGAGG - Intronic
1037755285 8:21706337-21706359 TCTTTTAGGCTGGAGCCGGGTGG + Intronic
1039206545 8:35161923-35161945 GGTTCCAGGCAGGAGCTGGGAGG - Intergenic
1039273994 8:35914930-35914952 TTTTTCAAGCAAGAACTGGTGGG - Intergenic
1039874448 8:41573747-41573769 TTTTTAAGTCTGGAGTTGGGAGG - Intergenic
1041406205 8:57501986-57502008 TTTTTCAGGATGGGGCTGAGAGG + Intergenic
1042789115 8:72583663-72583685 TTTTCAATGCAGGAGCTGAGGGG - Intronic
1045658791 8:104414389-104414411 TTTTTGAGGCAGCAGCTCTGGGG + Intronic
1046181601 8:110656135-110656157 TCTTTCAGGAAGGGGCTTGGTGG - Intergenic
1046870257 8:119197703-119197725 TTATTCAAGAAGGAGCTAGGTGG - Intronic
1047130953 8:122018787-122018809 TTTTGCAGGCAGGAGGTGGTGGG + Intergenic
1047202885 8:122781507-122781529 TTTTTCAGGCAGGAGCTGGGGGG - Exonic
1047411336 8:124627042-124627064 TTTAGCAGGCAGCAGCTGTGTGG + Intronic
1048097062 8:131308436-131308458 TCTTGCAGGCAGGGGCAGGGGGG - Intergenic
1048885153 8:138903739-138903761 TTTTTCAGCTAGGAGGTGGCAGG + Intronic
1049542059 8:143213144-143213166 TGTTTGAGGCTGGAGCTGGTGGG + Intergenic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1050324041 9:4483005-4483027 TTTTTCTTCCAGGAGCTGAGTGG + Intergenic
1052485707 9:29096655-29096677 TTTTTCTGGCAGGATCTATGTGG - Intergenic
1055054144 9:72008190-72008212 TTTTCCGGGCAGGGGCTGGAGGG - Intergenic
1056507130 9:87268094-87268116 TTTTTCAGTCAGGGGCCAGGTGG - Intergenic
1057260488 9:93580271-93580293 TTTTTGTGGCAGGACCTGGCAGG + Intronic
1060933715 9:127504320-127504342 TTTCCCAGGCAGGAGCTGGGTGG + Intergenic
1061217925 9:129232484-129232506 TTTCTCAGGAAGGAGGAGGGGGG - Intergenic
1061394587 9:130337098-130337120 TTATGGAGGCAGGAGCTGTGCGG + Intronic
1062458756 9:136654137-136654159 TGTTACCGGCAGGTGCTGGGAGG - Intergenic
1186446711 X:9635912-9635934 TTTTCCAGGCAGCAGCTGACAGG - Intronic
1186582300 X:10833433-10833455 TTGTTCAGGAAGGAGCTGTGGGG + Intronic
1187987320 X:24828468-24828490 GTTTTCAACCAGGAGCAGGGTGG + Intronic
1188465299 X:30472791-30472813 ATTTTCAGCCAGTACCTGGGAGG + Intergenic
1189148103 X:38675774-38675796 TCGTTCATGCAGCAGCTGGGGGG - Exonic
1190249313 X:48710082-48710104 TTGGTCAGGCAGGAGGTGGCAGG - Intergenic
1192051844 X:67731664-67731686 CTGTTTAGGCAGGAGCTGAGTGG - Intergenic
1192195042 X:69022395-69022417 TGTTTCAGACAGTAGCTGTGAGG + Intergenic
1192310865 X:70013116-70013138 GTGTTCAGGCAGGGGCAGGGTGG - Intronic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1194004832 X:88477538-88477560 TTTTTCAGGCTGGAGTGCGGTGG - Intergenic
1196648940 X:118149105-118149127 TTTTAGAGGCAGGACCTAGGTGG - Intergenic
1198593788 X:138214007-138214029 TTTATCAAGCAGTAGCAGGGAGG + Intergenic
1199437821 X:147832689-147832711 CATTCCAGGCAGGAGATGGGAGG + Intergenic
1201367648 Y:13225995-13226017 TTTTGCAGGCAGGAGATTGTTGG + Intergenic
1201460221 Y:14214145-14214167 TTTTTCAAGGAAGAGCAGGGAGG - Intergenic