ID: 1047202886

View in Genome Browser
Species Human (GRCh38)
Location 8:122781508-122781530
Sequence ATTTTTCAGGCAGGAGCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 384}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202886_1047202892 -10 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202886_1047202896 4 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202886_1047202897 5 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202886_1047202895 3 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202886_1047202894 2 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202886_1047202893 -1 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202886 Original CRISPR ATTTTTCAGGCAGGAGCTGG GGG (reversed) Exonic
900564020 1:3323607-3323629 GGTTTCCAGGCGGGAGCTGGGGG - Intronic
901195103 1:7436009-7436031 AATTTGCAAGCAGGAGCGGGAGG + Intronic
901221097 1:7584274-7584296 ATTTATCAGCAAGGAGCAGGGGG + Intronic
901357505 1:8663992-8664014 ATTTTACAGGCAGGATTGGGGGG - Intronic
901933044 1:12609159-12609181 ATTTTTCAGTCTGGGGATGGTGG + Intronic
902032378 1:13432309-13432331 ATTTCTCATGCAGGAGCTGCTGG - Intergenic
903203914 1:21766078-21766100 ATTTTCCAGGCTGGATGTGGTGG + Intronic
903639224 1:24847182-24847204 GATTTTCAGGCAGGATGTGGTGG - Intergenic
905402479 1:37713767-37713789 ATCGTGCAGGCAGGAGCTGAGGG + Intergenic
906802727 1:48751622-48751644 ATTTGCCAGGCAGGAAATGGAGG - Intronic
907321417 1:53605133-53605155 ATTTTACAGGGTGGAGCTGAGGG + Intronic
907911796 1:58833715-58833737 CTTTTACAGTCAGGAGCTGGGGG - Intergenic
909631574 1:77774288-77774310 CTTCTCCAGGGAGGAGCTGGAGG + Intergenic
910047076 1:82930969-82930991 ACTTTTCAAGCTGGAGTTGGAGG + Intergenic
910762038 1:90743008-90743030 ATTTTTCAGGCAGGGTGTGGTGG + Intergenic
911441863 1:97937056-97937078 ATATTTCAGGCAGGAGAGTGAGG + Intergenic
912088589 1:106041694-106041716 ATTTTTCATGCAGCAGTTTGGGG - Intergenic
912273293 1:108231319-108231341 ATTTTTCAGGCACCAGGTTGGGG + Intronic
912294927 1:108463003-108463025 ATTTTTCAGGCACCAGGTTGGGG - Intronic
912605673 1:110986391-110986413 ATGTATCAGGCAGCAGCTGATGG + Intergenic
915724059 1:158005316-158005338 TGTTTTCAGGAAGCAGCTGGTGG + Intronic
916225882 1:162489157-162489179 ATTTTTCAGGCAGCAACAGGAGG - Intergenic
917387340 1:174491528-174491550 CTTTTGCAGCCTGGAGCTGGAGG + Intronic
918827510 1:189344800-189344822 ATTTTTCAGGCTGGGCATGGTGG + Intergenic
920294864 1:204949833-204949855 ACACTTCAGGTAGGAGCTGGGGG + Intronic
921481641 1:215670905-215670927 TTTTTACAGGCAGGTGCTGACGG + Intronic
921926292 1:220712296-220712318 ATGTTTCAGGCAGAGGCTGAGGG + Intergenic
922252652 1:223864139-223864161 CTTCTCCAGGGAGGAGCTGGAGG + Intergenic
922412688 1:225391505-225391527 ATTCTCCAGGCAAGAGCTGCTGG + Intronic
923270586 1:232352013-232352035 ATTCTTCAGGGTGGTGCTGGTGG + Intergenic
924122879 1:240820462-240820484 TTTTTTTAGGCAGGGGGTGGGGG + Intronic
924548372 1:245051431-245051453 ATTTTGCAGCCAGAAGCTTGGGG + Intronic
1062932873 10:1364025-1364047 ATTTCTCAGGCCTGACCTGGGGG - Intronic
1063489285 10:6448158-6448180 TTTATTCAGGAAGGAGCTGAGGG + Intronic
1063752794 10:8970237-8970259 ATTATTCAGGCAAGAGATGATGG + Intergenic
1064047127 10:12026938-12026960 AATTTTCAGGCTGGAAATGGTGG - Intronic
1064675723 10:17758054-17758076 ATTTTTCTGGCTGCACCTGGTGG - Intronic
1064763055 10:18641659-18641681 AGGTTTCAGGCTGGATCTGGTGG - Intronic
1067925466 10:50504086-50504108 AATTTTCAGACAGGAGCTATGGG - Intronic
1068395017 10:56448931-56448953 ATCTTGCAGGCAGGAGATTGCGG + Intergenic
1071270017 10:83998393-83998415 ATTTTCCTGGAAGGAGCTGGAGG + Intergenic
1071385898 10:85121122-85121144 AGTTCTCAGGCTGGAGCTGTGGG - Intergenic
1071905238 10:90166127-90166149 ATTTTTGAGGCAAGAGATAGGGG + Intergenic
1072282552 10:93880861-93880883 AACTTTAAGGCAGGAGCTTGAGG + Intergenic
1072293829 10:93991380-93991402 AATTTTCAGAAAGGAGGTGGGGG - Intergenic
1072411793 10:95209451-95209473 ATTTTTCAGACAGCAGTTGAGGG - Intronic
1075414468 10:122252299-122252321 ATTTTTCAGTGAGGAAATGGAGG - Intronic
1075538824 10:123295179-123295201 ATTTTGGAGGGAGGAGATGGTGG + Intergenic
1077292282 11:1803396-1803418 CTTCTCCAGGGAGGAGCTGGTGG + Intergenic
1077755730 11:5025565-5025587 GTTTTGCAGTCATGAGCTGGGGG - Intergenic
1078476208 11:11632607-11632629 ATTTAGCAGGGAGGAGCTGGGGG + Intergenic
1080005156 11:27398803-27398825 ACTTTTCAGGCAGGACTTGACGG - Intronic
1080278279 11:30527430-30527452 ATTGTTAAGACAGGAGCCGGTGG + Intronic
1080463887 11:32479274-32479296 ATTTTAAGGGCAGGTGCTGGAGG - Intergenic
1080819893 11:35795390-35795412 ATAGTTCAAGCAGGAGATGGTGG + Intronic
1083066905 11:59932867-59932889 ATATTTCAGTCAGAAGTTGGGGG + Intergenic
1083420021 11:62547141-62547163 ATTTTGCAGGAAGGGCCTGGGGG + Intronic
1084498278 11:69518490-69518512 ATCTTACAGGCAGGAGCAGGAGG - Intergenic
1087068850 11:94054935-94054957 ATTTCTCAGGTAGGAGCAGAAGG + Intronic
1088281567 11:108139936-108139958 ATTTCTTAGGCCGGAGGTGGTGG - Intronic
1089255518 11:117192092-117192114 ATCTCTCATGCAGGAGGTGGCGG - Intronic
1089491405 11:118886462-118886484 TTCTTTAAGGCAGGGGCTGGGGG + Intronic
1089639140 11:119835717-119835739 ATTCTTCAAGCAGAAGCAGGAGG - Intergenic
1090685812 11:129117860-129117882 ATTTTTCAGTAAGAAGCGGGGGG - Intronic
1091291664 11:134443780-134443802 CTTTATCAGGCAGGAGAGGGAGG - Intergenic
1091627102 12:2129819-2129841 ATTAATCAGGCTGGTGCTGGAGG - Intronic
1091738698 12:2944457-2944479 AGTTCCCGGGCAGGAGCTGGAGG - Intergenic
1091780199 12:3208793-3208815 CTCTCTCAGGCAGAAGCTGGGGG - Intronic
1094535682 12:31320812-31320834 TTATTTCAAGCAGGAGCAGGGGG + Intronic
1096081796 12:48838261-48838283 TTTTTTCAGGCTGGACGTGGTGG + Intronic
1097152053 12:56986430-56986452 ATATTGGAGGCAGGAGCTGGTGG + Intergenic
1097584691 12:61501383-61501405 ATTTTTCAGAGAGAAGTTGGGGG + Intergenic
1100181825 12:92094309-92094331 ATTTTTCAGGCTGGATATGGTGG + Intronic
1101786118 12:107884984-107885006 ATATTTGAGGCAGGATGTGGTGG - Intergenic
1101830084 12:108250050-108250072 AATCTTCAGGCAGAAGCTTGTGG - Exonic
1101856680 12:108449514-108449536 ATTTTTCTTTCTGGAGCTGGAGG - Intergenic
1102392769 12:112562948-112562970 GTGGTTCAGGCAGGAGATGGTGG - Intergenic
1103164980 12:118762730-118762752 ACTTTTCACGCAGGGTCTGGGGG - Intergenic
1103469012 12:121165164-121165186 ATTCTTCTTGGAGGAGCTGGAGG + Intronic
1103844665 12:123893035-123893057 GTTTGACAGACAGGAGCTGGAGG + Intronic
1104119328 12:125784025-125784047 ATTTTTCAGGCTGGGCGTGGTGG + Intergenic
1105035483 12:132917441-132917463 TTTTTTTAGGCTGGACCTGGTGG - Intronic
1106292639 13:28379399-28379421 ATTTTTCAGGCAAGAACTGAAGG + Intronic
1106430963 13:29680233-29680255 TTTTTTTTGGCAGGGGCTGGGGG + Intergenic
1108359366 13:49655045-49655067 AGGTTACAGGCAGCAGCTGGCGG - Intergenic
1108368592 13:49744105-49744127 TTTTTTGATCCAGGAGCTGGTGG + Intronic
1109368796 13:61394446-61394468 AGTTTTCAGGTAGGTGATGGAGG + Intergenic
1110739836 13:78981800-78981822 ATTATGCAGGCAGAAGTTGGTGG + Intergenic
1110846675 13:80197602-80197624 ATTTTTCAGGCTGGGTGTGGTGG + Intergenic
1111883427 13:93988123-93988145 ATGTTTCTGGCAGGAGCTTGAGG - Intronic
1113347765 13:109497344-109497366 GTTTTTCAAGTTGGAGCTGGTGG + Intergenic
1113601459 13:111572182-111572204 GTATATCAGGAAGGAGCTGGAGG + Intergenic
1114355946 14:21908208-21908230 ATATCTCAGGCAGGAGTGGGCGG - Intergenic
1114483907 14:23052070-23052092 CTGCTTCAGGCTGGAGCTGGGGG - Exonic
1115170700 14:30502831-30502853 TTTTTTGAGGCAGGGGTTGGGGG - Intergenic
1117292624 14:54348303-54348325 AGTTTTCAGGAAAGAGTTGGTGG - Intergenic
1118726806 14:68634609-68634631 ATTTTCCAGGCAGGGGTGGGAGG - Intronic
1119749344 14:77066524-77066546 ATGATTCAGGGTGGAGCTGGAGG + Intergenic
1120004754 14:79343924-79343946 TTTTTTCAGGCAGGGCATGGTGG - Intronic
1120475534 14:84982278-84982300 ATTTTTCAGGCAGCTCGTGGAGG + Intergenic
1120656084 14:87191502-87191524 ATATTTCTGGAAAGAGCTGGTGG + Intergenic
1120708885 14:87772949-87772971 ATTTAATAGGCAGGACCTGGTGG + Intergenic
1121570009 14:94940444-94940466 CTCTTTGAGGCAGGGGCTGGGGG + Intergenic
1123205186 14:106705517-106705539 AGATTTCAGGCTGGGGCTGGTGG - Intergenic
1123210181 14:106751957-106751979 AGATTTCAGGCTGGGGCTGGTGG - Intergenic
1124023653 15:25945462-25945484 AATTTCCAGGCAGGAGCTACAGG + Intergenic
1124717098 15:32073612-32073634 ATATTGGAGGCAGGGGCTGGTGG + Intronic
1124921456 15:34030700-34030722 ATTTTTAACCCAGGAGTTGGAGG - Intronic
1125176597 15:36829780-36829802 ATTTTGGAGGTAGGACCTGGAGG + Intergenic
1126198185 15:45954961-45954983 ATCTCTCAGCCAGGAGGTGGTGG + Intergenic
1127638641 15:60894511-60894533 ATTTTTGAGGGAGTAGGTGGTGG + Intronic
1127764668 15:62173346-62173368 ATTTTTTAAGCAGCAGCTGTTGG - Intergenic
1128536393 15:68493853-68493875 CTATTCCAGCCAGGAGCTGGAGG - Intergenic
1129384947 15:75191299-75191321 ACTTTTCTGGAAGGAGCTGGAGG + Intergenic
1129899514 15:79135598-79135620 ATTTTTCAGGCAGGAGCAGTAGG - Intergenic
1130203987 15:81858962-81858984 ATTTTTCAGACAGGTGTTGTTGG - Intergenic
1130858651 15:87865587-87865609 ATTTTTCAGGGAGCATCTGAAGG - Intronic
1131552691 15:93371878-93371900 CTTTTTCAGGGAAGACCTGGTGG - Intergenic
1131853068 15:96563443-96563465 ATTATTCATGCAGGAGCAGCAGG - Intergenic
1131854873 15:96582871-96582893 ACAGTGCAGGCAGGAGCTGGTGG - Intergenic
1133089389 16:3391776-3391798 GTTTTTCAGGCTGGATGTGGTGG + Intronic
1134187005 16:12092241-12092263 ACTTGTCAGGCAGGATTTGGGGG - Intronic
1134212015 16:12285652-12285674 ATTTATGAGGCAGGCACTGGTGG - Intronic
1134450143 16:14358319-14358341 ATGTTTGAGGCTGGAGCAGGAGG + Intergenic
1135017078 16:18932752-18932774 ATTTTTCAAGCTGGTGCAGGAGG + Intergenic
1135556055 16:23437460-23437482 AATTCTAAGGCTGGAGCTGGGGG - Intronic
1136996000 16:35188402-35188424 CTTCTTCAGCCAGGAGATGGAGG - Intergenic
1137856827 16:51802855-51802877 ATTTTCCAGGCTGGACATGGTGG - Intergenic
1139323490 16:66134151-66134173 ATGTTTCCAGCTGGAGCTGGAGG + Intergenic
1139326926 16:66159982-66160004 AGGTTTCAAGCAGGATCTGGGGG + Intergenic
1139834308 16:69825909-69825931 ATTTTCCAGGCAGGGTGTGGTGG - Intronic
1141128985 16:81421783-81421805 ATTCTTCTGGCAGGGGCTGCAGG + Intergenic
1141521414 16:84582385-84582407 CTTTTTGAGGCTGGAGCAGGTGG - Intronic
1141539099 16:84705095-84705117 ATTTTTCTGGTATTAGCTGGAGG + Intronic
1142414622 16:89934652-89934674 GATGTTCAGGCAGGGGCTGGAGG + Intronic
1142623333 17:1178658-1178680 ATCTCCCAGGCAGGAGTTGGGGG - Intronic
1143104696 17:4523103-4523125 GTATTTCAGCCAGGACCTGGAGG - Intronic
1143635052 17:8159685-8159707 AGATTTCAGGCAGGAATTGGGGG + Exonic
1146089988 17:29867388-29867410 GTTTTTGTGGCAGGGGCTGGGGG - Intronic
1148137863 17:45306968-45306990 ATTTTTCAGGCCGGGAGTGGTGG + Intronic
1148505434 17:48123372-48123394 AACTTCCAGACAGGAGCTGGAGG + Intergenic
1148542476 17:48491774-48491796 ATTTTCCAGGAAAGAGGTGGGGG + Intergenic
1149058343 17:52391248-52391270 ATTAAAAAGGCAGGAGCTGGAGG - Intergenic
1150111530 17:62504514-62504536 ATTTTTTAGGCAGGGCATGGTGG + Intronic
1150122237 17:62613836-62613858 ATATTTCAGGCCGGGCCTGGTGG + Intronic
1151370678 17:73644689-73644711 ACTTTGCAGGCAGCATCTGGCGG + Intergenic
1151448783 17:74184455-74184477 TTTTTTCTGGCAGGAGTGGGGGG + Intergenic
1151533065 17:74720091-74720113 CTTTTGCAGGTAGGAACTGGAGG + Intronic
1152186470 17:78859702-78859724 ATCTTTCAGGCAGGGCATGGTGG + Intronic
1152739781 17:82013817-82013839 AGGTTTCAGGCAGGGGCGGGGGG - Intronic
1153087575 18:1305904-1305926 ATTTTTCAGTCGGGAGTTTGTGG + Intergenic
1153627414 18:7035096-7035118 ATTGGTCAGGCTGGAGATGGAGG + Intronic
1153871028 18:9320270-9320292 ATCTCTCATGCAGGTGCTGGTGG - Intergenic
1153973374 18:10246372-10246394 AATTATCAGGCAGGAGCAGCAGG - Intergenic
1154178161 18:12102465-12102487 AGTTTTCAGGAATGAGATGGCGG - Intronic
1154993023 18:21613983-21614005 ATTTTTTAGGCTGGACGTGGTGG + Intronic
1156345532 18:36253690-36253712 ATTTTTCAGGCAGTCACAGGCGG + Intronic
1156546186 18:37965906-37965928 ATTGTACAAGCATGAGCTGGAGG - Intergenic
1156806252 18:41185758-41185780 ATATTTGAGGCAGGAACTGGTGG + Intergenic
1156861136 18:41837584-41837606 ATGTTGCAGGCAGGGCCTGGTGG + Intergenic
1157458052 18:47855535-47855557 ATTTTTCAGACAAAAGCTGAGGG - Intronic
1158551169 18:58437468-58437490 ATTTTTAAGGCATGAGCCTGTGG + Intergenic
1158771150 18:60518822-60518844 ATGTTTCAGCCAGGTGCTGGTGG + Intergenic
1158786307 18:60716146-60716168 AAATATCAGGCAGGAGCTGGAGG + Intergenic
1158883295 18:61801592-61801614 ACATTCCAGGCAGGAGCAGGGGG + Intergenic
1159446984 18:68553404-68553426 TTTTTTCAGCCAGGTGCTGGTGG + Intergenic
1159712901 18:71785009-71785031 ATGATTGAAGCAGGAGCTGGTGG - Intronic
1159948504 18:74461248-74461270 ATCCTACAGGCAGGAGTTGGAGG - Intergenic
1161216445 19:3097143-3097165 GTTTTTCAGGGAGCAGCTAGAGG + Intronic
1161400038 19:4063207-4063229 GCTTTGCAGGCAGCAGCTGGGGG + Intronic
1162001701 19:7748503-7748525 AATTATCAGGAAGGAGCAGGTGG + Intergenic
1162008046 19:7792450-7792472 ACTTATCAGGCTGCAGCTGGTGG + Intergenic
1162025407 19:7891051-7891073 ATCCTACAGGCAGGACCTGGAGG + Intronic
1162259233 19:9518899-9518921 CTTCTTCAGGGAGAAGCTGGAGG - Intergenic
1162422448 19:10573560-10573582 AGTTTCCAGGCAGCAGATGGAGG + Intronic
1163443594 19:17333997-17334019 ATTTGTAAGGGAGGATCTGGGGG - Intronic
1163785687 19:19273719-19273741 ATTTTGCACCCAAGAGCTGGAGG - Intergenic
1166817715 19:45556910-45556932 ATTGCTCAGGCAGCAGGTGGCGG - Intronic
1167505903 19:49870976-49870998 GTGTTTCAGGAAGGAGCTGTGGG - Intronic
925094858 2:1189423-1189445 ATTATTGAAGCAGGAGTTGGGGG + Intronic
926379149 2:12267006-12267028 GTTTTTCAGACTGGGGCTGGGGG - Intergenic
926519011 2:13885619-13885641 ATATTACAGGCAGGAGAGGGTGG + Intergenic
926588502 2:14715223-14715245 ACTTTTCAGCCTTGAGCTGGGGG + Intergenic
927352738 2:22136945-22136967 ATTTTTCACGCAGGAGAGGATGG + Intergenic
927562630 2:24084523-24084545 ACTTCCCAGGCAGGAGCTCGGGG - Exonic
930653876 2:53989375-53989397 ATTTGTCAGGCAGGGCATGGTGG - Intronic
930665776 2:54096995-54097017 ATATTTCAGGCTGGATGTGGGGG - Intronic
931637086 2:64350614-64350636 ATTTGTCAGGCAGGAACAGGAGG - Intergenic
932564186 2:72895227-72895249 TTTTTTCAGTGAGGAGCTGGGGG + Intergenic
932766824 2:74475711-74475733 ACTCTTCAGGCAGGAGCTGTAGG + Exonic
933216075 2:79631527-79631549 ATTTTAGACGGAGGAGCTGGGGG + Intronic
934504417 2:94879755-94879777 CTTTTCCAGGCAAGAGCTGCTGG - Intergenic
934779159 2:96958355-96958377 ATTATTCAGGCCGGACGTGGTGG - Intronic
935368321 2:102318214-102318236 ATAATTCAGGCAAGAGATGGTGG + Intronic
935832750 2:107017470-107017492 ATTTTGGAGGTAGGGGCTGGTGG - Intergenic
936269675 2:111040329-111040351 ATTTTTCATGCAGCAGTAGGAGG - Intronic
939867475 2:147488901-147488923 ATTTTTCAGACATAATCTGGTGG - Intergenic
939984896 2:148820565-148820587 ATTATTCAGGCAGAAGCAGCTGG - Intergenic
940285874 2:152032676-152032698 ATTTTTTAGGCAGGGTGTGGTGG + Intronic
940484627 2:154281830-154281852 ACTTTTGAGGGAGCAGCTGGTGG - Intronic
941596710 2:167486072-167486094 ATTCTTCAGGCTGGACGTGGTGG + Intergenic
941881464 2:170484735-170484757 TTTTTTTAGGCAGCAGATGGTGG + Intronic
941958736 2:171231758-171231780 ATTTTTCAGGCTGGGTGTGGTGG + Intergenic
942296633 2:174523857-174523879 ATTTTCCAGGTATGAGGTGGAGG - Intergenic
942355929 2:175110047-175110069 ATTTTTCAGGCCGGGTGTGGTGG + Intronic
942659586 2:178250370-178250392 AGTTTTGAGGCAGGAGATGCTGG - Intronic
943100109 2:183477964-183477986 ATTTTGCAGGGAGGAGAAGGTGG - Intergenic
944231122 2:197393894-197393916 ATTTTTCAGGCCGGACATGGTGG + Intronic
944747254 2:202670695-202670717 ATTTTTCTAGCTGGAGTTGGTGG - Intronic
945634715 2:212333389-212333411 ATATTTCAGGCTGGACATGGTGG + Intronic
946132295 2:217616143-217616165 GTGTTTCAGGCAGTGGCTGGAGG - Intronic
946982969 2:225238488-225238510 ATTATTCAGATTGGAGCTGGAGG + Intergenic
948064875 2:235070137-235070159 ATTTTTCAGGCAGGAGGAAGGGG + Intergenic
948229431 2:236338795-236338817 ATTTTTCAGACATGAGATGCAGG - Intronic
948899434 2:240948923-240948945 ATTTTACACGCAGGATCTTGGGG + Intronic
949082130 2:242110519-242110541 TTCTGTCAAGCAGGAGCTGGAGG - Intergenic
1168838819 20:895540-895562 TTTTCACAGGCAGGGGCTGGGGG + Intronic
1168865815 20:1085614-1085636 ATATTCCAGGCAGGAGGAGGAGG + Intergenic
1168978590 20:1986414-1986436 ACTTTCCACGCAGCAGCTGGAGG + Intronic
1169486556 20:6039345-6039367 AGTTTTTAACCAGGAGCTGGTGG + Exonic
1169547302 20:6663442-6663464 ATTTTTCAGGCAGTAACAAGAGG - Intergenic
1172309698 20:33908171-33908193 CTGTTTCCTGCAGGAGCTGGGGG + Intergenic
1173062444 20:39675265-39675287 AGTGATGAGGCAGGAGCTGGTGG - Intergenic
1173256701 20:41398859-41398881 ATTTTTTAGGCTGGGGGTGGTGG + Intergenic
1174224212 20:48983850-48983872 ATTTACCAGGCCTGAGCTGGAGG - Intronic
1174254995 20:49247980-49248002 AGTCTTCAGGAAGCAGCTGGTGG + Exonic
1174284708 20:49464529-49464551 ACTTTTCAGGCAGGGAGTGGAGG - Intronic
1175100558 20:56575906-56575928 AGTGTCCAGGCAGGAGCTGATGG - Intergenic
1175570820 20:60020301-60020323 ATTTTTCTGGCCTGAGATGGGGG + Intronic
1177455542 21:21332764-21332786 AGTTTTCAGGCTGCAGCTGGGGG - Intronic
1177642932 21:23867407-23867429 ATTTTGTAGGCAGGAGCCAGAGG + Intergenic
1177810026 21:25915656-25915678 ATTTCTCAGGCAGGGGCAGCTGG + Intronic
1178983658 21:37285193-37285215 ATTTTTCAAGCCGGACATGGTGG + Intergenic
1179502166 21:41816667-41816689 AGAATTCTGGCAGGAGCTGGTGG - Intronic
1179780673 21:43698754-43698776 ACTTATCGGACAGGAGCTGGTGG - Intergenic
1179787615 21:43738684-43738706 ACTTATCGGACAGGAGCTGGTGG - Intronic
1179981405 21:44897744-44897766 GTTCTTCAGGGTGGAGCTGGAGG - Intronic
1180247249 21:46556394-46556416 ATTTTTCAGGCGGGGCGTGGTGG + Intronic
1180657667 22:17436877-17436899 AATCTTTAGGCAGGAACTGGGGG + Intronic
1180992279 22:19943881-19943903 ATGTGGCATGCAGGAGCTGGAGG + Intronic
1183239910 22:36650034-36650056 ATTGTCCAGGCAGGAGTTGGTGG - Intronic
1183342186 22:37287556-37287578 ACTCTTCCGGCAGGAGCTGGCGG - Intronic
1183468648 22:37993647-37993669 ATTTTACAGACAGGAGATTGAGG - Intronic
1183910347 22:41074575-41074597 CTTCTCCAGGGAGGAGCTGGAGG + Intergenic
1185046043 22:48529231-48529253 GGTGTTCAGGCAGGAGATGGGGG + Intronic
1185252429 22:49811448-49811470 AAGTTTCAGGCAGCCGCTGGAGG - Intronic
950070853 3:10151193-10151215 TTTTATCAGGCAGGACCAGGTGG + Exonic
950139511 3:10605569-10605591 GTTTGTGAGGCTGGAGCTGGAGG + Intronic
950984813 3:17350900-17350922 ATTTGTGAAGCAGGAGCTTGTGG - Intronic
951910852 3:27748974-27748996 ATTCATCAGGCAGGAAATGGAGG + Intergenic
952096386 3:29959877-29959899 ATGTTGCAGGAAGGATCTGGTGG - Intronic
952314845 3:32223690-32223712 ATGGTCCAGCCAGGAGCTGGGGG + Intergenic
952382276 3:32815048-32815070 ATTGTTTAGGCAAGAGATGGTGG + Intergenic
953294422 3:41699310-41699332 ATTTTTCAGGGAAAGGCTGGAGG - Intronic
955229080 3:57083296-57083318 ATTTTTGAGGCTGGATATGGTGG - Intergenic
955354757 3:58222240-58222262 ATTTTCCAGGCAGGAATTGTTGG + Intergenic
956833183 3:73073448-73073470 ATTTTGCAGGCCGGAAGTGGTGG + Intergenic
956949681 3:74267428-74267450 ATTTTACACGGAGGAGATGGCGG + Intronic
957330345 3:78755222-78755244 ATTTTGGAGGCAGATGCTGGAGG + Intronic
958914105 3:100028397-100028419 ATATTCCAGGCAACAGCTGGTGG + Intronic
959655678 3:108801554-108801576 ATGTTGCAGGTAGGACCTGGTGG - Intergenic
960945731 3:122965152-122965174 GTTTCTTGGGCAGGAGCTGGGGG + Intronic
961783232 3:129333890-129333912 ATCTCCCAGGCAGGAGCTAGGGG - Intergenic
961995594 3:131238608-131238630 ACTTTTCAGCCATGACCTGGAGG + Intronic
962426605 3:135274236-135274258 GTCTTTCAGGCAGAAGCTGCTGG + Intergenic
962456894 3:135573114-135573136 ATCACTCAGGCAGGAGCTGCAGG + Intergenic
963016566 3:140829378-140829400 ATGGTTCAGGCAAGAGATGGTGG - Intergenic
966079091 3:175977902-175977924 CTTCTCCAGGAAGGAGCTGGAGG + Intergenic
966401805 3:179555221-179555243 TTTTTTTAAGCAGGAGGTGGAGG - Intergenic
966515967 3:180821183-180821205 CTTCTCCAGGGAGGAGCTGGAGG - Intronic
968654463 4:1772596-1772618 AAGAGTCAGGCAGGAGCTGGGGG + Intergenic
968661736 4:1801472-1801494 GTTCTTCAGCCAGGAGATGGAGG - Exonic
968982542 4:3858183-3858205 ACTGTTCAGGAAGGAGCTGTAGG - Intergenic
969183799 4:5460973-5460995 AGGGTTCTGGCAGGAGCTGGAGG + Intronic
969303932 4:6314317-6314339 ATTTCTCAGGAAGTTGCTGGAGG - Intergenic
969510711 4:7616226-7616248 CTTTTTCAGCCAGGAGTGGGAGG - Intronic
969836843 4:9849159-9849181 AGTTTGCAGGCAGAAGCTGTAGG + Intronic
971544604 4:27869573-27869595 ATTTTTCAGGCTGGGCCTGGTGG - Intergenic
972053841 4:34774803-34774825 AATTTTCAGGCAGGAGGTTAGGG + Intergenic
972541579 4:40043708-40043730 GTATTTCCGGCAGGAGCAGGAGG - Intergenic
972739791 4:41878726-41878748 ATTCTAGAGGCAGGAGCCGGGGG - Intergenic
973113751 4:46428655-46428677 ATTATTCAGGCAGGTCATGGTGG - Intronic
973223717 4:47758198-47758220 ATTTTTCAGGCTGGGCGTGGTGG - Intronic
973329403 4:48897100-48897122 ATGTTGCAGGGAGGAGGTGGGGG - Intronic
973368713 4:49228285-49228307 ATGTTGGAGGCAGGACCTGGTGG - Intergenic
973392332 4:49567129-49567151 ATGTTGGAGGCAGGACCTGGTGG + Intergenic
973530930 4:51836193-51836215 ATTCTTAACTCAGGAGCTGGTGG + Intergenic
973584117 4:52374150-52374172 ATTGTTCAGGTAAGAGGTGGAGG + Intergenic
976386269 4:84462659-84462681 ATTTTTCTGGTAATAGCTGGAGG - Intergenic
976690016 4:87858948-87858970 AGTTTTCACCCAGCAGCTGGGGG - Intergenic
976731299 4:88264974-88264996 ACTTTTCAGGCAGAAGCTCTGGG + Intronic
976740956 4:88357163-88357185 ATTTTTCAGGGAGGATCTTTGGG - Intergenic
976957843 4:90925012-90925034 AATTTTTAGGCAGGGGGTGGTGG - Intronic
977324229 4:95554543-95554565 ACTTTTCAGGCAGAAGAAGGTGG + Intergenic
978810900 4:112848447-112848469 ATTTTTCTGGCAGGGTGTGGTGG - Intronic
978952118 4:114573305-114573327 ACTTTTCAGGCTGGACATGGTGG + Intergenic
979016236 4:115437277-115437299 TTTTCTCAGCCAGGACCTGGAGG + Intergenic
979885788 4:126025736-126025758 ATTTTTGAGGAAGGTCCTGGTGG + Intergenic
980943148 4:139294228-139294250 AATTTTCAGGCCGGACGTGGTGG - Intronic
981473740 4:145166552-145166574 ATGTTTCAGGCAGGATGTGGTGG + Intronic
981588041 4:146325726-146325748 ATGATTTAGCCAGGAGCTGGAGG + Intronic
982749734 4:159145758-159145780 AGGTTTCAGGGAGGAGCTGGAGG + Intronic
982952594 4:161718713-161718735 GTATTTCAGGCAGGACATGGTGG - Intronic
983428758 4:167620552-167620574 ATTTTTCAAACATGGGCTGGTGG + Intergenic
983871879 4:172832922-172832944 GTTTTTCTAGCTGGAGCTGGTGG - Intronic
984561091 4:181271330-181271352 ATTTTTCAAGCAGCAGCATGTGG - Intergenic
984654832 4:182306341-182306363 ATCTTTCAGGCTGGACATGGTGG - Intronic
984710116 4:182877826-182877848 ATCTTTTGGGAAGGAGCTGGTGG - Intergenic
986291736 5:6405391-6405413 ATTTCTCAGGCTGGGCCTGGTGG - Intergenic
986311903 5:6557260-6557282 CTTCCTCAGGCAGGAACTGGAGG - Intergenic
986486481 5:8243299-8243321 ATTTGTCAGACAGGAAATGGGGG - Intergenic
987996707 5:25291711-25291733 CTTTGGGAGGCAGGAGCTGGTGG + Intergenic
988015992 5:25560263-25560285 ATTTTTTAGGCTGGATGTGGTGG - Intergenic
988896885 5:35684571-35684593 AGTTCTCAGGCAGCTGCTGGAGG - Intronic
990652028 5:57911561-57911583 ATTGCTCAAGCAGAAGCTGGAGG - Intergenic
991006388 5:61832342-61832364 CTTCTCCAGGGAGGAGCTGGAGG + Intergenic
991245135 5:64502585-64502607 ATATTTCTTGCAGGAGCTGGGGG - Intergenic
991494185 5:67211513-67211535 ATTTTTTAGGCCGGACGTGGTGG - Intergenic
992993260 5:82306944-82306966 ATTTTACAGGCAGGACCTGTAGG + Intronic
994316502 5:98339420-98339442 CTTCTCCAGGGAGGAGCTGGAGG - Intergenic
995486030 5:112640953-112640975 CTCTTCCAGGCAGCAGCTGGTGG - Intergenic
995743141 5:115375928-115375950 ATATTTCAGGCTGGGCCTGGTGG - Intergenic
995824658 5:116282155-116282177 AGGTTTCTGGCAGAAGCTGGAGG - Intronic
995992120 5:118253239-118253261 ATTTTTTAGGCAGTTGCTGAGGG - Intergenic
996076758 5:119204107-119204129 ATTTTTCAGGCCGGGCGTGGTGG - Intronic
997075272 5:130667254-130667276 CTTTTGCAGGATGGAGCTGGAGG + Intergenic
997165794 5:131659404-131659426 CTTCTCCAGGGAGGAGCTGGAGG + Intronic
998294215 5:140951650-140951672 ATTTTGTAGGCAGGCCCTGGTGG - Intronic
999059958 5:148623258-148623280 ATTTTTCCTGAAGGACCTGGGGG - Intronic
999904349 5:156123068-156123090 ATTTTCCAGGTGGAAGCTGGTGG + Intronic
999964690 5:156796771-156796793 ATTTTTCAGCTTGGAGCTGCAGG + Intergenic
1001089669 5:168727915-168727937 AGCTTGGAGGCAGGAGCTGGAGG + Intronic
1001692963 5:173646486-173646508 ATTTATCAAGCAGTAGCTGTCGG + Intergenic
1002443185 5:179274803-179274825 ATGTGCCAGGCAGGGGCTGGTGG + Intronic
1002709398 5:181185408-181185430 ATTTTTGAGGCAGGGGTTGGGGG - Intergenic
1003179270 6:3778160-3778182 AATTTTCATGCAGCAGCTCGAGG + Intergenic
1005431932 6:25767445-25767467 ATTTTTCAGGCAAAATTTGGGGG + Intronic
1005689207 6:28285628-28285650 TTATCCCAGGCAGGAGCTGGAGG - Exonic
1005968175 6:30742188-30742210 ATGGTTCAGGCTGGAGCTGGAGG + Exonic
1006422907 6:33946586-33946608 TGCTTTCAGGCAGGAGCTGTTGG - Intergenic
1006789828 6:36692626-36692648 ATTTTGGAGTCAGTAGCTGGAGG + Intergenic
1006861012 6:37171322-37171344 CTTCTTCTGGCAGGTGCTGGAGG + Exonic
1007128454 6:39447400-39447422 ATTGTTCAGGCAGGAGATAAGGG - Intronic
1008202468 6:48608047-48608069 GTTTTTCAGGTAAGATCTGGTGG - Intergenic
1009535433 6:64877040-64877062 ATATTTCAGGCAAGAGATGATGG + Intronic
1011283892 6:85704194-85704216 ATTTTTCAGGCTGGGTGTGGTGG + Intergenic
1011345673 6:86367573-86367595 ATGTTGGAGGTAGGAGCTGGTGG + Intergenic
1011430307 6:87279375-87279397 ATGTTTCAGGCAGGAAGGGGTGG + Intergenic
1011526987 6:88276296-88276318 CTTCTCCAGGGAGGAGCTGGAGG + Intergenic
1011548580 6:88507459-88507481 CTTTTTCAGGCTGGATGTGGTGG + Intergenic
1011556560 6:88575740-88575762 AGATTTCAGGCAGGAGGTAGAGG + Intergenic
1015382072 6:132581100-132581122 ATTTTTAAGTCAGGAGCATGTGG + Intergenic
1016161816 6:140891970-140891992 ATTTTTCAGGCAATAGCTCTAGG + Intergenic
1016270957 6:142289891-142289913 CTTTTTGAGGCTGGAGGTGGTGG - Intergenic
1016896091 6:149054495-149054517 ATCTTACAGGCTGGAGTTGGGGG + Intronic
1018646435 6:165952947-165952969 AATTTTCAGGTAGGACCTGAGGG - Intronic
1019063045 6:169270930-169270952 ATTTTTCAGGCACTATCTTGTGG - Intergenic
1019177025 6:170165229-170165251 AGCTTCCAGGCAGGAGCAGGCGG - Intergenic
1019389519 7:778207-778229 CTTTTTAAAACAGGAGCTGGCGG + Intronic
1022092654 7:27117698-27117720 TGTTTTCAGGCAGGGGATGGAGG - Intronic
1022301991 7:29110427-29110449 ACTTTTCAGCCAGGAGCTTCAGG + Intronic
1022644914 7:32220902-32220924 ACAGTTCAGGCATGAGCTGGAGG - Intronic
1023710643 7:42988732-42988754 GTTTCTCAGGCTGGGGCTGGGGG - Intergenic
1024010216 7:45260442-45260464 ATTGTAGAGACAGGAGCTGGAGG + Intergenic
1024564374 7:50669483-50669505 ATTTTGGAGGCAGGGCCTGGTGG - Intronic
1026189084 7:68108309-68108331 ATTTTTCAGCCAGTAGATGAAGG + Intergenic
1026434340 7:70381778-70381800 ATTTAGCAGGTAGGAGCAGGAGG - Intronic
1027717607 7:81692736-81692758 ATTAGTCAGGCAAAAGCTGGTGG + Intergenic
1029646872 7:101862458-101862480 ATTTCACAGGCAGCAGCTGAAGG - Intronic
1029647858 7:101869482-101869504 AATTTAAAGGCAAGAGCTGGAGG + Intronic
1031490432 7:122381144-122381166 AGCTTTCAGCCAGGAGCTGGGGG - Intronic
1031584504 7:123518315-123518337 ATTTTTTTGGCAGGGGTTGGTGG - Intronic
1032040731 7:128558426-128558448 ATTTTTTAGGCAGGGCATGGTGG + Intergenic
1032415201 7:131730161-131730183 AGTTTTCTGGGAGGGGCTGGGGG + Intergenic
1032434946 7:131892957-131892979 AGTTTTTAGGCTGGAACTGGTGG + Intergenic
1032562433 7:132906422-132906444 ATCTTTCAGGAAAGAGGTGGAGG - Intronic
1033321569 7:140344466-140344488 ATTTTTCTGGCTGGGGATGGTGG + Intronic
1034384607 7:150729745-150729767 ATGTTAGAGGCAGGACCTGGTGG + Intronic
1034738681 7:153453514-153453536 ATACTTCAGGCAGGAACTGCAGG - Intergenic
1035540046 8:427230-427252 TTCTGTCAAGCAGGAGCTGGAGG - Intronic
1036053566 8:5226537-5226559 TTTTCTCAGGCAGGAGCTTCAGG - Intergenic
1036813608 8:11885185-11885207 ATTTAGCAGGAAGGAGCTGAGGG - Intergenic
1037554484 8:20008975-20008997 ATTTGGCAGGCAGGGGTTGGGGG - Intergenic
1038896157 8:31784754-31784776 AGTTTTCTGGCAGGAGCAGTTGG - Intronic
1039273995 8:35914931-35914953 ATTTTTCAAGCAAGAACTGGTGG - Intergenic
1039616280 8:38957170-38957192 TTTTTCAAGGCAGGAGCTGAAGG + Intronic
1041110739 8:54480129-54480151 ATTTTTCTGTCTGGAGCTGGTGG - Intergenic
1042789116 8:72583664-72583686 ATTTTCAATGCAGGAGCTGAGGG - Intronic
1043800373 8:84602172-84602194 ATGTTTCAGTCTGGAGCTCGAGG - Intronic
1044712680 8:95072754-95072776 CTTTTTCAGGCTGGTGCTGCTGG + Intronic
1044738046 8:95299240-95299262 ATAGATCAGGCAGGGGCTGGTGG - Intergenic
1045409552 8:101903631-101903653 GTATTTCAGGGAGGAGGTGGAGG - Intronic
1047045454 8:121047802-121047824 AATTTTCTGCCAGGAGCTAGGGG + Intergenic
1047130952 8:122018786-122018808 GTTTTGCAGGCAGGAGGTGGTGG + Intergenic
1047202886 8:122781508-122781530 ATTTTTCAGGCAGGAGCTGGGGG - Exonic
1047698426 8:127426807-127426829 ATTTCCAAGGGAGGAGCTGGGGG - Intergenic
1049133847 8:140875634-140875656 ATTTTTAAGGAGGGAGCTGATGG - Intronic
1049542058 8:143213143-143213165 TTGTTTGAGGCTGGAGCTGGTGG + Intergenic
1050374973 9:4961358-4961380 ATTTTTCAGGCTGGGTGTGGTGG - Intergenic
1053236146 9:36456142-36456164 ATTGCTGAGGCAGGAGGTGGAGG - Intronic
1055054145 9:72008191-72008213 TTTTTCCGGGCAGGGGCTGGAGG - Intergenic
1056217831 9:84421789-84421811 ATTTTTCAGGGATGATTTGGTGG + Intergenic
1057572537 9:96215544-96215566 ATTCTCCAGACAGGATCTGGAGG + Intergenic
1058084267 9:100731923-100731945 CTTCTCCAGGGAGGAGCTGGAGG - Intergenic
1058103030 9:100937828-100937850 AACTCTCAGGCAGGGGCTGGTGG + Intergenic
1060119454 9:120974490-120974512 ATCTTTCAGCCAGGATCAGGAGG + Intronic
1060401046 9:123349826-123349848 CTTTTTGAGGCGGGAGCAGGCGG - Intergenic
1060575172 9:124685321-124685343 CTTTTTCTGGGAGGAGTTGGGGG + Intronic
1061927391 9:133812583-133812605 GTTCTGGAGGCAGGAGCTGGGGG - Intronic
1062428663 9:136517321-136517343 ATTGTGCAGGCAGGGGCTGCTGG + Exonic
1185864347 X:3609741-3609763 ATTCTTCAGGCTGGATGTGGTGG - Intronic
1186582299 X:10833432-10833454 TTTGTTCAGGAAGGAGCTGTGGG + Intronic
1187089983 X:16086005-16086027 AAATTTCAGGCAGGAGATTGGGG - Intergenic
1187185656 X:16982720-16982742 TTCTTCCAGGCAGAAGCTGGTGG + Intronic
1191923340 X:66280435-66280457 ATGTTGAAGGCAGGATCTGGTGG - Intergenic
1192409651 X:70922048-70922070 GCATTTCAGGCAGTAGCTGGAGG - Intergenic
1196059398 X:111391120-111391142 ATTTTGGAGGCGGGACCTGGTGG + Intronic
1196279194 X:113802927-113802949 ATTCCTCTGGCAGGAGCAGGAGG - Intergenic
1197465312 X:126798123-126798145 ATATTGCAGGAAGGACCTGGTGG - Intergenic
1201499120 Y:14622449-14622471 ATCTTTCATCCAGGTGCTGGGGG - Exonic
1202051261 Y:20783134-20783156 ATTTGTCAGTCATGAGATGGAGG - Intergenic