ID: 1047202887

View in Genome Browser
Species Human (GRCh38)
Location 8:122781509-122781531
Sequence CATTTTTCAGGCAGGAGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 377}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202887_1047202897 4 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202887_1047202893 -2 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202887_1047202894 1 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202887_1047202896 3 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202887_1047202895 2 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202887 Original CRISPR CATTTTTCAGGCAGGAGCTG GGG (reversed) Exonic
900232468 1:1567489-1567511 CATGTTTCCGTCAGGATCTGTGG - Intronic
901357506 1:8663993-8664015 CATTTTACAGGCAGGATTGGGGG - Intronic
903926107 1:26831822-26831844 CATTCTTCAGGTTGGAGCTTAGG + Intronic
904627252 1:31814124-31814146 CAGTATCCAGGGAGGAGCTGAGG + Exonic
904659319 1:32072995-32073017 CATATTGCCCGCAGGAGCTGCGG + Exonic
905402478 1:37713766-37713788 CATCGTGCAGGCAGGAGCTGAGG + Intergenic
906644418 1:47463590-47463612 CATTTTCCAGGTTGGAGTTGAGG + Intergenic
907321416 1:53605132-53605154 GATTTTACAGGGTGGAGCTGAGG + Intronic
907911797 1:58833716-58833738 ACTTTTACAGTCAGGAGCTGGGG - Intergenic
908065315 1:60396967-60396989 CATTTGTAAAGCAGGAGCTCTGG + Intergenic
908689637 1:66763896-66763918 AACTTTTCAGGCAGGTGCAGTGG + Intronic
909129688 1:71718991-71719013 CATATTTGAAGCTGGAGCTGAGG + Intronic
909901534 1:81142544-81142566 CATTCTTTAGTCAGGAGGTGAGG + Intergenic
910525883 1:88177639-88177661 CACTGATCAGGCAGCAGCTGTGG - Intergenic
910598447 1:89005155-89005177 CTTTATTCAGCCAGGAGCTTTGG - Intergenic
910811536 1:91242450-91242472 CTTTATTCAGCCAGGAGCTTCGG + Intergenic
911602843 1:99865978-99866000 CATTATTAAGCCAGGTGCTGTGG + Intronic
912056472 1:105605348-105605370 CATTTTACAGCCAGGTGCGGTGG + Intergenic
912273292 1:108231318-108231340 CATTTTTCAGGCACCAGGTTGGG + Intronic
912294928 1:108463004-108463026 CATTTTTCAGGCACCAGGTTGGG - Intronic
913139037 1:115922151-115922173 CATTTTACAGAGAGGACCTGAGG - Intergenic
914334826 1:146704708-146704730 CCTGATTCAGGCAGGAACTGAGG + Intergenic
914784407 1:150815570-150815592 AATTTTTCAGCCAGGCGCGGTGG + Intronic
914946237 1:152069049-152069071 CATTTTACTTGCAGGAGATGAGG - Intergenic
915268302 1:154734076-154734098 CATTTTCCAGGCAGGCCCAGAGG + Intronic
915466902 1:156103462-156103484 CATTTTGCATACAGTAGCTGAGG + Intronic
916648928 1:166816941-166816963 CATGGAGCAGGCAGGAGCTGGGG - Intergenic
917220669 1:172725295-172725317 CAGTTTTCATGCAGGCCCTGAGG - Intergenic
918341786 1:183573800-183573822 CATATTTTAGGCAGGTGCGGTGG + Intronic
918469744 1:184859853-184859875 CATTGCTCAGCAAGGAGCTGAGG + Intronic
919617659 1:199827393-199827415 CTTTTTTCAGCCAGGTGCAGTGG - Intergenic
920294863 1:204949832-204949854 CACACTTCAGGTAGGAGCTGGGG + Intronic
920735113 1:208526689-208526711 CATTTGTCAGGCAACAGCTGTGG - Intergenic
921417566 1:214908281-214908303 CATTTTTCAGACACAAACTGGGG - Intergenic
921926291 1:220712295-220712317 GATGTTTCAGGCAGAGGCTGAGG + Intergenic
922463315 1:225829144-225829166 CAGTGCTCAGGCAGGAGATGGGG + Intronic
923628361 1:235632525-235632547 TATTTTTCAGACAGGAGGAGTGG + Intronic
923778215 1:236998585-236998607 CCTTTTATTGGCAGGAGCTGAGG + Intergenic
924124833 1:240839685-240839707 CATTGTTCACTCAGGATCTGGGG - Intronic
924933527 1:248748808-248748830 CAATTTTTAGGCAGGAACTGTGG - Intronic
1062932874 10:1364026-1364048 CATTTCTCAGGCCTGACCTGGGG - Intronic
1063489284 10:6448157-6448179 GTTTATTCAGGAAGGAGCTGAGG + Intronic
1064163258 10:12964083-12964105 CATTTTCCAGCCGGGAGCGGTGG + Intronic
1065496732 10:26336898-26336920 CATTATTCAGCCAGGTGCGGTGG - Intergenic
1065832070 10:29623561-29623583 CATTTGCCAGGCAGGCGCGGAGG + Intronic
1066198449 10:33124354-33124376 CATTATACAGCCAGGAACTGAGG + Intergenic
1066619365 10:37327825-37327847 CTTTTTTCAGACAAGTGCTGAGG + Intronic
1067322989 10:45239932-45239954 CATTTTACAGGCCTAAGCTGTGG + Intergenic
1067366422 10:45634235-45634257 CATTTCTCAGCCAGGCGCGGTGG + Intronic
1067389099 10:45847236-45847258 GATCTATGAGGCAGGAGCTGGGG - Exonic
1067416962 10:46109710-46109732 GATCTATGAGGCAGGAGCTGAGG + Intergenic
1067445157 10:46337313-46337335 GATCTATGAGGCAGGAGCTGAGG + Intergenic
1067502373 10:46816605-46816627 GATCTATGAGGCAGGAGCTGAGG + Intergenic
1067592214 10:47523415-47523437 GATCTATGAGGCAGGAGCTGAGG - Exonic
1067925467 10:50504087-50504109 CAATTTTCAGACAGGAGCTATGG - Intronic
1068515057 10:58015578-58015600 CACTTTTCAGTTAAGAGCTGTGG - Intergenic
1069005566 10:63314267-63314289 TATTTCTCAGGCAGGGGATGTGG + Intronic
1069375581 10:67789380-67789402 TATTTTTCAGCCAGGCGCAGTGG + Intergenic
1069501324 10:68955902-68955924 CATTTATCAGGCTGGGGCTAGGG + Intergenic
1070136321 10:73697644-73697666 GATCTATGAGGCAGGAGCTGGGG - Exonic
1071385899 10:85121123-85121145 CAGTTCTCAGGCTGGAGCTGTGG - Intergenic
1072411794 10:95209452-95209474 CATTTTTCAGACAGCAGTTGAGG - Intronic
1072515192 10:96175006-96175028 CATTTGTAAGGCAGGAATTGGGG + Intronic
1073298086 10:102453202-102453224 CCTTTTGAAGGCAGGTGCTGGGG + Intergenic
1075762857 10:124870042-124870064 TACTTTGCAGGCTGGAGCTGGGG - Intergenic
1078182915 11:9027549-9027571 CCTTTTTCAGACAGAAGATGTGG - Exonic
1078276209 11:9850082-9850104 CCTTCTGCTGGCAGGAGCTGAGG + Exonic
1078378059 11:10813233-10813255 CTTTTTTCAGCCAGGCGCGGTGG + Intronic
1078389226 11:10921738-10921760 CATTTGTCAGGCGGGTGCAGTGG + Intergenic
1078476207 11:11632606-11632628 CATTTAGCAGGGAGGAGCTGGGG + Intergenic
1078961887 11:16285243-16285265 TATTTTTAAGGCAGGTGCAGTGG + Intronic
1080465288 11:32490612-32490634 TACTTTCCAGGCAGGAGCTCAGG - Intergenic
1080545526 11:33314107-33314129 CATTATTCAGCCAGGTGCAGTGG - Intronic
1080774098 11:35369791-35369813 ATGTATTCAGGCAGGAGCTGGGG + Intronic
1081194090 11:40140066-40140088 TATTATTAAGGCAGGAACTGGGG - Intronic
1081517790 11:43850367-43850389 CACTCTTAAGGCAGAAGCTGGGG - Intronic
1082052914 11:47787373-47787395 AATTTTTCAGCCAGGTGCAGTGG - Intronic
1082930840 11:58603460-58603482 AATTTTTCAGGAAAGATCTGTGG + Intronic
1083015579 11:59449878-59449900 TATGTTCCAGGTAGGAGCTGGGG + Intergenic
1084623440 11:70289940-70289962 TATTTTTCAGCCAGGTGCAGTGG + Intronic
1085316160 11:75546287-75546309 CCTCTGTCAGGCATGAGCTGGGG + Intergenic
1088207071 11:107404533-107404555 CATTTGTGTTGCAGGAGCTGGGG + Intronic
1088682858 11:112259124-112259146 CATTTTACAGACAAGAACTGAGG - Intronic
1088883966 11:113992909-113992931 CTTCTTTCATGCAGCAGCTGGGG + Intergenic
1089358676 11:117872459-117872481 CATATGTCAGGCAGGCCCTGTGG - Intronic
1089491404 11:118886461-118886483 CTTCTTTAAGGCAGGGGCTGGGG + Intronic
1091486220 12:891423-891445 CATCTTTCAGCCAGGCGCGGTGG - Intronic
1091620135 12:2081281-2081303 CATTTTTCGGCCAGGTGCGGTGG + Intronic
1092748897 12:11699910-11699932 CATTTTTCCAACAGGAGCTCAGG - Intronic
1094535681 12:31320811-31320833 CTTATTTCAAGCAGGAGCAGGGG + Intronic
1094563565 12:31578947-31578969 CATTTATGAGGCATGAACTGTGG - Intronic
1096061409 12:48703646-48703668 TATTTTTCAGCCAGGTGCAGTGG + Intronic
1096120226 12:49083983-49084005 CATTTTTCAGCCGGGTGCAGTGG + Intergenic
1096668958 12:53186573-53186595 CTTTTGTCAGGCAGGAGTGGAGG - Intronic
1097021105 12:56021385-56021407 CATTTCGCAGGCAGCAGCAGCGG - Intronic
1098923851 12:76327858-76327880 CATTTTTTTGGCAGGTGATGGGG + Intergenic
1100125410 12:91418711-91418733 AAAATCTCAGGCAGGAGCTGAGG + Intergenic
1100717222 12:97318707-97318729 CATTTTTAAGGCAATAGATGGGG - Intergenic
1100723257 12:97381052-97381074 AGTTTTTCAGGCAGTAGATGTGG - Intergenic
1100819523 12:98418484-98418506 CATTGGTCTGGCAAGAGCTGTGG - Intergenic
1100852105 12:98723017-98723039 CATTTTACAGACAGAAGCTGCGG - Intronic
1100939381 12:99708873-99708895 CATTTATGAGACAGGACCTGTGG - Intronic
1102060310 12:109926467-109926489 CATGAAGCAGGCAGGAGCTGGGG + Intronic
1104952740 12:132449362-132449384 AATTTTTCAGCCAGGTGCGGTGG - Intergenic
1106505274 13:30365735-30365757 CATTTCTTTGGCAGGAGCTTTGG + Intergenic
1106628449 13:31444635-31444657 CAGTTTGAAGGCAGGAGCTGAGG - Intergenic
1106845043 13:33729561-33729583 CAGTTTTCAGCCGGGAGCGGTGG + Intergenic
1107111345 13:36701351-36701373 CATCTCTCAGGGAGGAGATGAGG - Intergenic
1107157830 13:37190437-37190459 CATTTTTGAGGTAGGAGGTAGGG + Intergenic
1107689059 13:42933809-42933831 CAATTTTCAGCCAGCAGCTCTGG - Intronic
1107853760 13:44594892-44594914 CATTTGTGTTGCAGGAGCTGGGG - Intergenic
1107906712 13:45067985-45068007 AATTTTACAGAGAGGAGCTGTGG + Intergenic
1109229667 13:59741599-59741621 AATTGGTCAGGCAGGAGCTGAGG + Intronic
1109978090 13:69868863-69868885 CTTTTTTCAGGTAGGAATTGAGG - Intronic
1110010843 13:70331652-70331674 CATTTTTGTGGCAGGGGTTGGGG + Intergenic
1110268033 13:73560743-73560765 CATTTTTCTGGGAGGTGTTGAGG - Intergenic
1110617319 13:77555397-77555419 CTTTTTTCAGGAAGCAGCTGAGG + Intronic
1111696864 13:91635699-91635721 CAATTTTCAGGAAGTAGCAGTGG - Intronic
1112516394 13:100056752-100056774 CTTTTTTCAGGGAGGTGATGGGG - Intergenic
1115253458 14:31373616-31373638 AATGTTTCAGCCAGGTGCTGTGG - Intronic
1116287599 14:42992394-42992416 CATTTCTCAGCCAGGCGCGGTGG + Intergenic
1117417029 14:55506588-55506610 TATTTTTCAGCCAGGTGCAGTGG - Intergenic
1117486332 14:56201419-56201441 AATTATCCAGGAAGGAGCTGGGG + Intronic
1120794473 14:88617431-88617453 CAGTTTTCAGTCAGGCGCGGTGG - Exonic
1121523750 14:94604055-94604077 CATTTTTAAAGAAGGAGCAGGGG + Intronic
1122133149 14:99617895-99617917 CATTTTACTTGCAGAAGCTGGGG + Intergenic
1122530946 14:102426560-102426582 CAGTTTTCAGCCAGGCGCAGTGG + Intronic
1123485539 15:20733569-20733591 AATTATTAAGGCAGAAGCTGGGG + Intergenic
1123539374 15:21273055-21273077 CATTTTACAGAGAGGAGCTAGGG - Intergenic
1123542026 15:21302618-21302640 AATTATTAAGGCAGAAGCTGGGG + Intergenic
1124270887 15:28279482-28279504 CATTTTTCTGTCAGTAACTGTGG - Intronic
1126233501 15:46354643-46354665 CAATATTCAGCCAGGAGGTGGGG - Intergenic
1130161712 15:81407938-81407960 CCCTTTGCGGGCAGGAGCTGGGG + Intergenic
1131430200 15:92381321-92381343 CAGTTTTCAGGCTAAAGCTGTGG + Intergenic
1132282580 15:100633103-100633125 CATTATTCAGGCAGGTGCTATGG - Intronic
1202947684 15_KI270727v1_random:214-236 CATTTTACAGAGAGGAGCTAGGG - Intergenic
1202950344 15_KI270727v1_random:29758-29780 AATTATTAAGGCAGAAGCTGGGG + Intergenic
1132649083 16:1012465-1012487 CATCTTGCTGGGAGGAGCTGGGG + Intergenic
1132844959 16:1996471-1996493 CATTTTTTAGCCAGGGGCGGTGG + Intergenic
1133059877 16:3167447-3167469 CATTTTTCAGGGAGGGGATAGGG + Intergenic
1133763442 16:8818594-8818616 CATTTCTCAGCCAGGCCCTGAGG + Intronic
1136265817 16:29117409-29117431 CATTTCGCAGGCGGGAGCTGGGG + Intergenic
1137017878 16:35394428-35394450 CATTTTTGGGGAATGAGCTGTGG - Intergenic
1137608255 16:49801316-49801338 TGACTTTCAGGCAGGAGCTGAGG - Intronic
1137820367 16:51438901-51438923 GAAGTTTCAGGCAGGAGCAGAGG + Intergenic
1138662960 16:58536019-58536041 TACTTTTCAGCCAGGTGCTGTGG - Intronic
1139326925 16:66159981-66160003 CAGGTTTCAAGCAGGATCTGGGG + Intergenic
1139511391 16:67430400-67430422 CATTTGTGAGGCAGGAAGTGGGG + Intergenic
1139998797 16:71006528-71006550 CCTGATTCAGGCAGGAACTGAGG - Intronic
1140034238 16:71360432-71360454 GAATTTTATGGCAGGAGCTGGGG - Intronic
1142054633 16:87985316-87985338 CAGTTCGCAGGCGGGAGCTGGGG + Intronic
1142168414 16:88606252-88606274 AATTTTTCAGGATGGTGCTGAGG + Intronic
1142591547 17:1008343-1008365 CACCCTCCAGGCAGGAGCTGTGG + Intronic
1142623334 17:1178659-1178681 CATCTCCCAGGCAGGAGTTGGGG - Intronic
1145273361 17:21416278-21416300 CATTGGCCAGGTAGGAGCTGCGG - Exonic
1145311550 17:21703722-21703744 CATTGGCCAGGTAGGAGCTGCGG - Exonic
1146587072 17:34091491-34091513 CATTATGCAGCCAGGAACTGGGG + Intronic
1149383775 17:56121909-56121931 CATTCCTCAGGAAGGTGCTGGGG + Intronic
1149565284 17:57636725-57636747 CATTTCTGGGGCAGGAGATGAGG - Intronic
1150095081 17:62366977-62366999 CATTTTTCAGCCAGGCACGGTGG + Intergenic
1150166220 17:62946184-62946206 CAGTTTTCAGTCAGGTGCGGTGG + Intergenic
1150802932 17:68295965-68295987 TATTTTTTAGGCCGGAGCAGTGG - Intronic
1150950540 17:69798792-69798814 TATTTTTCGGCCAGGAGCAGTGG - Intergenic
1151423453 17:74014154-74014176 CCTTTGTCAGGCAAGAGCCGAGG + Intergenic
1151771623 17:76166389-76166411 CATATTCCTGGCAGCAGCTGTGG - Intronic
1152216191 17:79034054-79034076 CATTTTCCAGGCAGCTCCTGAGG - Intronic
1152739782 17:82013818-82013840 CAGGTTTCAGGCAGGGGCGGGGG - Intronic
1153188297 18:2509960-2509982 CATTTGTCAGCCAGGTGCGGTGG - Intergenic
1154075734 18:11199088-11199110 CATTTGTCAGCCAGGTGCAGTGG - Intergenic
1154469167 18:14681596-14681618 CTTTTTTCAGCCAGGTGCAGTGG - Intergenic
1154958887 18:21288088-21288110 GATTTTTAAGCCAGGCGCTGTGG - Intronic
1156183716 18:34637353-34637375 CATGTTTCAGGCAGCAACAGTGG - Intronic
1156655137 18:39276091-39276113 CATTTTACAAGCAAGAGTTGTGG + Intergenic
1157120115 18:44901301-44901323 CTTTGTTCAGGCAGGAGCAATGG + Intronic
1157458053 18:47855536-47855558 AATTTTTCAGACAAAAGCTGAGG - Intronic
1157561247 18:48647996-48648018 CCTTTCCCTGGCAGGAGCTGGGG + Intronic
1158108013 18:53906827-53906849 CATTTTTTTGGCAGGAGCCTTGG + Intergenic
1158355494 18:56613878-56613900 CATTTTTAAGCCAGGTGCAGTGG + Intronic
1159725327 18:71950951-71950973 CATTATTCAGGCAGGAACTGGGG + Intergenic
1159822039 18:73157472-73157494 CATTTTTCAGCCAGGCGTGGTGG - Intronic
1161251286 19:3281696-3281718 CAGGGTTCAGTCAGGAGCTGGGG - Intronic
1161274256 19:3406738-3406760 CATTTTTCAGGAGGGATGTGAGG + Intronic
1161879394 19:6937303-6937325 CATTTTTCAGATTGGACCTGTGG + Exonic
1163588010 19:18174242-18174264 TACTTTTGGGGCAGGAGCTGGGG + Intronic
1164217662 19:23163879-23163901 CTTTATTCAGCCAGGAGCTTTGG + Intergenic
1164855754 19:31519408-31519430 CTTTTTTAAGAGAGGAGCTGTGG + Intergenic
1166769030 19:45269479-45269501 CTTTATTGGGGCAGGAGCTGGGG + Intronic
1166940538 19:46361414-46361436 GATTTTTCAGCCAGGCGCAGTGG - Intronic
1167088617 19:47327977-47327999 CATTTTTCAGCCGGGCGCGGTGG - Intergenic
1167159955 19:47760814-47760836 CATTTTTTAGGCCGGTGCAGTGG + Intergenic
1167505904 19:49870977-49870999 TGTGTTTCAGGAAGGAGCTGTGG - Intronic
1167525660 19:49982231-49982253 CTTTGTTCAGGCATGAGCTACGG - Intronic
1168619601 19:57867589-57867611 TATTTTTCAGCCAGGTGCAGTGG + Intronic
925572424 2:5325953-5325975 CCTGTATCAGTCAGGAGCTGCGG + Intergenic
925991816 2:9260449-9260471 CAATTTTGGGGTAGGAGCTGCGG + Intronic
926629891 2:15126599-15126621 CATCTTTCAGCCATGGGCTGAGG - Intergenic
927806238 2:26149238-26149260 CATTTGTGTTGCAGGAGCTGGGG - Intergenic
929513558 2:42585373-42585395 CACTTTTCAGCCAGGCGCGGTGG - Intronic
930362786 2:50402822-50402844 CAATTTACAGGGAGGAGTTGAGG - Intronic
930784053 2:55253389-55253411 CAATTTTCAGCCAGGCGCGGTGG + Intronic
931723648 2:65087086-65087108 CATTCTTCACGCAGGGGCTTGGG - Exonic
932445967 2:71781864-71781886 CATGTTTCAGGTGGGAGGTGTGG + Intergenic
932564185 2:72895226-72895248 CTTTTTTCAGTGAGGAGCTGGGG + Intergenic
933216074 2:79631526-79631548 CATTTTAGACGGAGGAGCTGGGG + Intronic
935131197 2:100262243-100262265 GCTTTTTGAGGAAGGAGCTGCGG + Intergenic
935227412 2:101065100-101065122 CAGTGTCCATGCAGGAGCTGTGG - Intronic
939215915 2:139238261-139238283 CATGATGCAGACAGGAGCTGGGG + Intergenic
941345063 2:164358224-164358246 CATTATTCAGGAAGTAGCTGGGG + Intergenic
941396587 2:164981593-164981615 CATTTTACAGAGAGGAGCTAGGG - Intergenic
941440425 2:165528840-165528862 CATGGGTCTGGCAGGAGCTGGGG + Intronic
943791728 2:191940616-191940638 AATTTTTCTGTCAGGATCTGAGG - Intergenic
944363263 2:198884346-198884368 CATTTTTCAGACAGAAACTTTGG - Intergenic
945542404 2:211105199-211105221 CCTTTTCCAGGCAGGTGATGCGG - Intergenic
946647435 2:221852820-221852842 GGTTTTTCAGGAAAGAGCTGGGG - Intergenic
947210856 2:227707295-227707317 TATTTTTCAGCCAGGCGCGGTGG + Intronic
947773754 2:232691369-232691391 CATTTTCCAGCCAGGCGCGGTGG - Intergenic
947899906 2:233712627-233712649 CGTTTATCAGGCTGCAGCTGAGG - Intronic
947900602 2:233718458-233718480 TATTTATCAGGCTGCAGCTGAGG - Intronic
947901996 2:233728761-233728783 TGTTTATCAGGCAGCAGCTGAGG - Intronic
947903934 2:233745892-233745914 CGTTTTTCAGGGAGCAGCTGAGG + Intronic
947904053 2:233746848-233746870 CGTTTATCAGGCTGCAGCTGAGG - Intronic
948064874 2:235070136-235070158 CATTTTTCAGGCAGGAGGAAGGG + Intergenic
948153562 2:235764317-235764339 CGATTTTCAGGGAAGAGCTGTGG + Intronic
948732500 2:239975908-239975930 CATTTTCCTGGCTGGTGCTGTGG - Intronic
948899433 2:240948922-240948944 CATTTTACACGCAGGATCTTGGG + Intronic
1168787991 20:556441-556463 CATTTATCAGCCAGGTGCGGTGG + Intergenic
1168891434 20:1297410-1297432 CATCTTACAGACAGGAACTGAGG - Intronic
1169592209 20:7157394-7157416 CATAGTTCAGGTAGGAGATGAGG + Intergenic
1169787652 20:9377303-9377325 CAGTTTTCAGCCAGGATTTGGGG - Intronic
1169970401 20:11263737-11263759 CATTTATCAGTCAGGTGCAGTGG + Intergenic
1170099475 20:12682841-12682863 CTGTTGTGAGGCAGGAGCTGGGG + Intergenic
1170171960 20:13424712-13424734 CATTTTTCAATCAGTAGTTGAGG - Intronic
1170669511 20:18418204-18418226 CAGTTTTCAGCCTGGAGCTAAGG + Intronic
1170893242 20:20393310-20393332 CACATTTCAGGGAGGATCTGTGG + Intronic
1171346860 20:24471553-24471575 CCGTTTTCAGGCAGGAAATGGGG - Intronic
1172309697 20:33908170-33908192 CCTGTTTCCTGCAGGAGCTGGGG + Intergenic
1172782547 20:37445694-37445716 AATTTTACAGCCAGGTGCTGTGG - Intergenic
1173097435 20:40049428-40049450 CATTATTAAGGCAGGTTCTGGGG - Intergenic
1173249269 20:41356096-41356118 CATTTCTCAGCCAGGTCCTGAGG - Intronic
1177455543 21:21332765-21332787 GAGTTTTCAGGCTGCAGCTGGGG - Intronic
1179510560 21:41870514-41870536 CATTTTTCAGGATGGTTCTGCGG - Intronic
1180657666 22:17436876-17436898 CAATCTTTAGGCAGGAACTGGGG + Intronic
1180831720 22:18910169-18910191 CAGTGCTCAGGCAGGCGCTGCGG + Exonic
1181068130 22:20316200-20316222 CAGTGCTCAGGCAGGCGCTGCGG - Exonic
1181134855 22:20757865-20757887 CATTATTCAGACAAGACCTGAGG - Intronic
1181752903 22:25002152-25002174 CATTTGTCATGGAGGTGCTGTGG + Intronic
1183269147 22:36849902-36849924 AATTATTCAGGCAGGAGAGGAGG + Intergenic
1183821052 22:40346380-40346402 CAATTCTCAGGCAGAAGCAGCGG + Intergenic
1183869505 22:40730571-40730593 CACTTTTCAGCCAGGTGCTGTGG - Intergenic
1184520739 22:44992526-44992548 CATCTAACAGGCAGGAGCGGAGG + Intronic
1184570405 22:45320175-45320197 GATTTTTCAGCCAGTTGCTGTGG + Intronic
1184903927 22:47465975-47465997 CACATTTCAGGCAGGGGCTGTGG - Intronic
1203281800 22_KI270734v1_random:135440-135462 CAGTGCTCAGGCAGGCGCTGCGG + Intergenic
949789103 3:7773221-7773243 CACTTTTTAGGCAGCAGATGGGG + Intergenic
950467085 3:13162011-13162033 CATTTGCCAGGCAGGCGCTGTGG - Intergenic
950869689 3:16218117-16218139 CATTTCTCAGGCAGATGCTCAGG + Intronic
951039660 3:17975326-17975348 CATAATTCAGCCAGGCGCTGTGG - Intronic
951067867 3:18288739-18288761 CAAATTTCAGCCAGGAGCTCAGG - Intronic
951708679 3:25568582-25568604 CATATTTGGGGTAGGAGCTGAGG - Intronic
952147381 3:30548269-30548291 CATTTTTGAGCCCGGAGCTCAGG + Intergenic
952314844 3:32223689-32223711 CATGGTCCAGCCAGGAGCTGGGG + Intergenic
953535568 3:43774425-43774447 CATCCTTCAGGCAGGGGCTCTGG + Intergenic
954440873 3:50521353-50521375 CATCTATCAGGCACCAGCTGGGG + Intergenic
956055320 3:65292453-65292475 CATATTCCAGGCAGGAGTGGAGG - Intergenic
956384577 3:68703178-68703200 CCTTGTCCAGGCAGCAGCTGGGG - Intergenic
956559248 3:70555477-70555499 CATTTTTAAGCCAAGAGCAGTGG - Intergenic
956722805 3:72133290-72133312 CATTCTACAGGCTGGAGATGGGG + Intergenic
961066591 3:123881981-123882003 CCATTTTCAGGCAGCAGGTGGGG + Intronic
961465789 3:127080741-127080763 CAGCTTTGAGGGAGGAGCTGAGG + Intergenic
962287042 3:134095077-134095099 CATTAGTCAGGCAGCAGATGAGG + Intronic
963267410 3:143253050-143253072 TTTTGTTCAGGCAGCAGCTGTGG + Intergenic
964043931 3:152298586-152298608 CATTTTTAAAGCAGAAGCTGAGG - Intronic
966629142 3:182052613-182052635 CATTTTTCAGCCACTAGCTGTGG - Intergenic
968118006 3:196104473-196104495 CATTTATCATGGAGGAGGTGGGG + Intergenic
968654462 4:1772595-1772617 CAAGAGTCAGGCAGGAGCTGGGG + Intergenic
968741073 4:2332044-2332066 CATTTACCAAGCATGAGCTGCGG - Intronic
969586070 4:8094360-8094382 CTTTATTCAGCCAGGAGCTTCGG + Intronic
969918096 4:10509962-10509984 CATGCTTCAGTCAGGAGATGGGG - Intronic
970533798 4:17008679-17008701 CATTTTTAGGGCAGGTGCGGTGG - Intergenic
971379193 4:26081351-26081373 CATTTTGGAGGCAGGAGCAAGGG - Intergenic
971485716 4:27158097-27158119 CATTTATCAGGCAGGTGCAGTGG + Intergenic
972053840 4:34774802-34774824 GAATTTTCAGGCAGGAGGTTAGG + Intergenic
973041423 4:45474612-45474634 CGTTTTTCAGCCAGGGTCTGCGG - Intergenic
974831900 4:67200007-67200029 CAGTATTCAGGCAGGAGGAGAGG - Intergenic
975757635 4:77586900-77586922 CAGTTTGTAGGCAGGAGATGTGG - Intronic
976690017 4:87858949-87858971 CAGTTTTCACCCAGCAGCTGGGG - Intergenic
976731298 4:88264973-88264995 GACTTTTCAGGCAGAAGCTCTGG + Intronic
976740957 4:88357164-88357186 AATTTTTCAGGGAGGATCTTTGG - Intergenic
979701762 4:123676275-123676297 CAATTTTCTGGCAGAAGCAGAGG + Intergenic
979832609 4:125319144-125319166 CATTTTCCAGGCCAAAGCTGTGG + Exonic
981274896 4:142887409-142887431 CATTTTTAAGGGAGAAGATGAGG + Intergenic
981690477 4:147502698-147502720 CACTGTTCAGGCAGTAGTTGAGG + Intronic
982346332 4:154364651-154364673 CAGTTTCCAGGCAGAAGCAGCGG + Intronic
982738188 4:159028806-159028828 CATTTTCTAGGCAGGTGCGGTGG + Intronic
984658523 4:182346844-182346866 GACTTGACAGGCAGGAGCTGCGG - Exonic
985998435 5:3611014-3611036 CATTTGTCAGCCAGCAGCAGCGG + Intergenic
986963956 5:13247567-13247589 CTTTCTTAAGCCAGGAGCTGAGG + Intergenic
987212254 5:15694751-15694773 CATTTTTAAGGCAGGAGCTGGGG + Intronic
988016995 5:25572139-25572161 CATTGTTCATGAATGAGCTGTGG - Intergenic
988388300 5:30595028-30595050 AATTTTTCAGGCAACAGCAGGGG - Intergenic
988984213 5:36601035-36601057 CATTTTTTTGGCAGGAGGTCTGG - Intergenic
989038790 5:37204867-37204889 CATTTTTCAGCCGGGCGCAGTGG + Intronic
989096411 5:37785758-37785780 CTTTATTCAGCCAGGAGCTTTGG + Intergenic
991031173 5:62083890-62083912 CAGATTTCTGGCAGGAGATGTGG + Intergenic
991245136 5:64502586-64502608 CATATTTCTTGCAGGAGCTGGGG - Intergenic
991917601 5:71620491-71620513 AATTTTGCAGGGAGGAACTGAGG + Intronic
991995452 5:72382112-72382134 CTTTATTCAGGCTGGGGCTGAGG - Intergenic
992224356 5:74605152-74605174 AATTTTTCAGCCAGGCGCAGTGG + Intergenic
992410245 5:76498472-76498494 CAAACCTCAGGCAGGAGCTGTGG + Intronic
994198232 5:96943141-96943163 CATTATTGAGCCAGGAGTTGAGG + Intronic
995992121 5:118253240-118253262 CATTTTTTAGGCAGTTGCTGAGG - Intergenic
996040251 5:118801129-118801151 CTTTATTCAGCCAGGAGCTTCGG - Intergenic
997589005 5:135061629-135061651 CATTTCTGAGTGAGGAGCTGGGG + Intronic
997643119 5:135462705-135462727 GATTTTTTAGATAGGAGCTGAGG + Intergenic
997804686 5:136905468-136905490 TATTTCTCAGGCAGCAGCTTTGG + Intergenic
998433155 5:142083977-142083999 CTTTCTTCAGGCAGGAACAGGGG + Intergenic
998442285 5:142172674-142172696 CAGTTTTCAGTCAGGTGCGGTGG - Intergenic
999059959 5:148623259-148623281 CATTTTTCCTGAAGGACCTGGGG - Intronic
999582784 5:153058293-153058315 CATTTTACAGTCAGGAAATGAGG + Intergenic
1000124973 5:158235364-158235386 CAGATTTCAGGGAGGAGCTAGGG - Intergenic
1000400623 5:160823567-160823589 CATATTTCAGCCAGGCTCTGTGG + Intronic
1000925512 5:167189081-167189103 CATTTTCCAGGAAGGAGGTGAGG - Intergenic
1002388283 5:178887902-178887924 AATTTTTCTGGCAGGGGCAGGGG - Intronic
1002709399 5:181185409-181185431 TATTTTTGAGGCAGGGGTTGGGG - Intergenic
1004062686 6:12213554-12213576 CACTTTTCAGCCAGGTGCAGTGG + Intergenic
1004354310 6:14918012-14918034 CTTTTTTCAGCCAGGCGCAGTGG + Intergenic
1004538631 6:16527371-16527393 CATGAATCAGGCAGGAGATGGGG + Intronic
1005041108 6:21601283-21601305 CATTTTTCAGGAAGAATCAGAGG - Intergenic
1005431931 6:25767444-25767466 CATTTTTCAGGCAAAATTTGGGG + Intronic
1005502168 6:26438459-26438481 CATTTTTGACACAGCAGCTGAGG - Intergenic
1006347873 6:33497948-33497970 CATGGAACAGGCAGGAGCTGGGG + Intergenic
1006500823 6:34457860-34457882 CATGGAGCAGGCAGGAGCTGGGG + Intergenic
1006902885 6:37514371-37514393 CATTGTTCATCCAGGAGGTGGGG + Intergenic
1007128455 6:39447401-39447423 AATTGTTCAGGCAGGAGATAAGG - Intronic
1008123954 6:47648064-47648086 CTTTATTCAGCCAGGAGCTTTGG - Intergenic
1008544456 6:52573467-52573489 CATTTTTTAGCCAAGTGCTGTGG + Intronic
1009494105 6:64327907-64327929 CACTTTTCAGGCAAGGGCTCTGG - Intronic
1009717176 6:67412695-67412717 AATTTTGCAGGCAGGTGCTCGGG - Intergenic
1010033597 6:71295191-71295213 TATTTATCAGGCAGGAGGAGTGG + Intronic
1011747664 6:90421926-90421948 CACATGTGAGGCAGGAGCTGAGG + Intergenic
1013375409 6:109509765-109509787 CATGGAGCAGGCAGGAGCTGCGG + Intronic
1013444524 6:110209954-110209976 AATTTTTTTGGGAGGAGCTGGGG - Intronic
1014464837 6:121742689-121742711 CATTTTTCAGCCAGGCGCGGTGG - Intergenic
1016896090 6:149054494-149054516 CATCTTACAGGCTGGAGTTGGGG + Intronic
1016901498 6:149107504-149107526 CATTTTTCAGCCAGGTGCAGTGG - Intergenic
1018646436 6:165952948-165952970 TAATTTTCAGGTAGGACCTGAGG - Intronic
1019096981 6:169589972-169589994 TATTTTTCAGGCAAAAGATGAGG + Intronic
1019126418 6:169843394-169843416 CATTCTCCAGGCAGGAGATGGGG - Intergenic
1019398641 7:837372-837394 CCTTTGTCGGGCAGGTGCTGTGG + Intronic
1022165817 7:27760679-27760701 AATTTTTCAGCCAGGTGCGGCGG - Intronic
1022177491 7:27885746-27885768 AAATTTTCAGGAAGGAGATGGGG - Intronic
1022377953 7:29832342-29832364 CATTTTACAGGCTGGTGCTAAGG - Intronic
1022857139 7:34326232-34326254 AATCTCTCAGGCAGCAGCTGAGG + Intergenic
1022916224 7:34956788-34956810 CATTTTTCGGCCAGGCGCAGTGG - Intronic
1024500521 7:50100523-50100545 CATTTTTCAGTCAGGCACGGTGG + Intronic
1025805033 7:64823165-64823187 AATTTTTCAGCCAGGCGCAGTGG - Intronic
1027262297 7:76473515-76473537 CATTTTGCAGTCAGGTGCAGTGG + Intronic
1027313678 7:76971612-76971634 CATTTTGCAGTCAGGTGCAGTGG + Intergenic
1027333829 7:77127195-77127217 CATGGAGCAGGCAGGAGCTGGGG - Intronic
1028765084 7:94546488-94546510 AATTTTTCAGGAATGAGTTGAGG + Intronic
1029781964 7:102744119-102744141 CATGGAGCAGGCAGGAGCTGGGG + Intergenic
1030120688 7:106107905-106107927 CATTTATCAGCCAGGCGCGGTGG + Intronic
1031130626 7:117829356-117829378 CATATTTTGGGCAGAAGCTGAGG - Intronic
1031315660 7:120255148-120255170 CAGTTTTCAGGTGGGAGCTTGGG - Intergenic
1031367578 7:120921683-120921705 CATTTATCATGCAAGATCTGTGG + Intergenic
1031490433 7:122381145-122381167 CAGCTTTCAGCCAGGAGCTGGGG - Intronic
1031822208 7:126517407-126517429 CATTTTACAGACACGAGCTGAGG + Intronic
1032862032 7:135889539-135889561 TATTTTTCAGCCAGGTGCGGTGG + Intergenic
1033218505 7:139511928-139511950 TGTTTTACAGCCAGGAGCTGTGG + Intergenic
1033271926 7:139939739-139939761 CATATTTAAGGGAGGAGCGGAGG + Intronic
1033454622 7:141491657-141491679 CATTTTTCAGACATGAGTTTAGG + Intergenic
1033823052 7:145156758-145156780 CATTTTTCAGCCAGGCACGGTGG - Intergenic
1034952636 7:155310689-155310711 CGGTTTTCAGGCAGGAGGAGCGG + Intergenic
1035293487 7:157854671-157854693 CATCTTTGAGCCAGGGGCTGGGG - Intronic
1035609595 8:951536-951558 CATTTATCAGCCAGGTGCAGTGG - Intergenic
1036163203 8:6407354-6407376 CATTTTACAGGCAGAAACTAAGG + Intronic
1036813609 8:11885186-11885208 CATTTAGCAGGAAGGAGCTGAGG - Intergenic
1037199962 8:16240352-16240374 CATTCTACAGGCAGGAAATGTGG - Intronic
1037957721 8:23071795-23071817 CATTTTACAGGAAGGAGCTGGGG - Intergenic
1037962063 8:23105215-23105237 CACTTTACAGGCAGGAGCTGGGG - Intronic
1037969390 8:23161194-23161216 CACTTTACAGGCAGGAGCTGGGG + Intronic
1038612299 8:29068319-29068341 CACTTGGCAGGCAGGAGGTGCGG - Exonic
1039238313 8:35527292-35527314 CATCTTTCAGGAAGGAGCTCTGG - Intronic
1039382078 8:37095178-37095200 CATTTGTGTTGCAGGAGCTGGGG - Intergenic
1039413710 8:37376260-37376282 CACTTTTGAGGCATGAGCTTAGG - Intergenic
1040425925 8:47286284-47286306 CTTTTTTCAGCCAGCAGCTGTGG - Intronic
1042789117 8:72583665-72583687 TATTTTCAATGCAGGAGCTGAGG - Intronic
1044816007 8:96113742-96113764 CATCTTTCAGGTGGGACCTGGGG - Intergenic
1045183138 8:99808231-99808253 CAGTTTTCAGCCAGGTGCAGTGG + Intronic
1045220051 8:100190021-100190043 AACTTTTCAGGCAGGCGCGGTGG + Intronic
1046372514 8:113327991-113328013 TATTTTTTAGGCAGGATCTCAGG - Intronic
1047045453 8:121047801-121047823 CAATTTTCTGCCAGGAGCTAGGG + Intergenic
1047202887 8:122781509-122781531 CATTTTTCAGGCAGGAGCTGGGG - Exonic
1047413611 8:124645078-124645100 CATTTTTCAGCCAGGTGCAGTGG + Intronic
1047698427 8:127426808-127426830 CATTTCCAAGGGAGGAGCTGGGG - Intergenic
1048048615 8:130796362-130796384 CTTTATTGAGGCAGGGGCTGTGG + Intronic
1050695825 9:8278106-8278128 CATTTTTCAGCCTTGAGCCGGGG - Intergenic
1052167105 9:25345368-25345390 CATTTTTCGGCCAGGCGCAGTGG + Intergenic
1055816691 9:80214159-80214181 CATTTTTCAGTGAGGTGTTGAGG - Intergenic
1056703748 9:88933931-88933953 CTTTATTCAGGCAGGAGCTTTGG + Intergenic
1056993593 9:91433562-91433584 CATTTTTAAGGCAGGAGAAAAGG - Intergenic
1057260532 9:93580492-93580514 CACTTTGCAGGCAGGAGTGGAGG - Intronic
1057795100 9:98150216-98150238 CACTTGTCAGCCAGGCGCTGTGG - Intronic
1059283262 9:113152198-113152220 CTTTTTTCAGGGTGGGGCTGTGG - Intronic
1062120584 9:134831975-134831997 GATTTTTCAGCCAGGTGCAGGGG + Intronic
1062176514 9:135166189-135166211 CATTTTTCAGCCAGGCGATGTGG - Intergenic
1186582298 X:10833431-10833453 ATTTGTTCAGGAAGGAGCTGTGG + Intronic
1188481256 X:30639086-30639108 CATTTTTCTGGCAGGCCCTGAGG + Intergenic
1188678271 X:32970058-32970080 CATTTTGGAGGCAAGAGTTGAGG - Intronic
1189082170 X:37986232-37986254 CTTTATTCAGCCAGGAGCTTCGG + Intronic
1189692907 X:43635623-43635645 TATTTTTCAGGCAGAAAATGAGG - Intergenic
1191731080 X:64336043-64336065 CATTTTGAAGGAAGGGGCTGAGG - Intronic
1192357389 X:70417213-70417235 GATTTTTCAGCCAGGCGCGGTGG + Intronic
1192413753 X:70958833-70958855 CATTTCTAAGCCAGGCGCTGTGG + Intergenic
1193907373 X:87260192-87260214 CATTTTTCATGCAGGACCTTTGG - Intergenic
1194767618 X:97860440-97860462 CCATTTTCAGGAAGAAGCTGAGG + Intergenic
1194801835 X:98283325-98283347 CTTTTTTCAGAAGGGAGCTGTGG + Intergenic
1195024958 X:100867305-100867327 CATTTTTTTGCCAGGCGCTGTGG - Intronic
1195095161 X:101494355-101494377 CAGTTTTGAGTCTGGAGCTGGGG + Exonic
1197832241 X:130655923-130655945 CATTTAACAGCCAGGCGCTGTGG - Intronic
1198133015 X:133717693-133717715 CTTTATTCAGCCAGGAGCTTTGG - Intronic
1198148217 X:133880349-133880371 CATTTCTGAGGCAGTAGCTGCGG - Intronic
1201400631 Y:13600438-13600460 CATTATTCAGCCAGGAGCATTGG + Intergenic