ID: 1047202888

View in Genome Browser
Species Human (GRCh38)
Location 8:122781510-122781532
Sequence TCATTTTTCAGGCAGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 285}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202888_1047202897 3 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202888_1047202893 -3 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202888_1047202896 2 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1047202888_1047202894 0 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202888_1047202895 1 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202888 Original CRISPR TCATTTTTCAGGCAGGAGCT GGG (reversed) Exonic
902775317 1:18670943-18670965 GCACTTTTGAGGCAGGAGTTGGG - Intronic
903028425 1:20445624-20445646 GCATCCTTCAGGCAGGCGCTGGG + Intergenic
904176972 1:28636944-28636966 TTATTTTCCAGGCTGGAGCATGG - Intronic
904996921 1:34638578-34638600 TCAGTTATCAGCCAGGACCTAGG + Intergenic
906250366 1:44306497-44306519 TCATTTTTCAGGAAGAGGCAGGG + Intronic
912273291 1:108231317-108231339 CCATTTTTCAGGCACCAGGTTGG + Intronic
912294929 1:108463005-108463027 CCATTTTTCAGGCACCAGGTTGG - Intronic
917501821 1:175592522-175592544 TCACTTTTCCGGCTGGTGCTGGG + Intronic
917516148 1:175710295-175710317 TCACTGTCCAGCCAGGAGCTAGG - Intronic
918004023 1:180525060-180525082 TCATAATACAGGCAGGAGCAGGG - Intergenic
919244086 1:194954921-194954943 TCATGTTTCAGGAAAGATCTTGG - Intergenic
920852125 1:209635134-209635156 TCATTTTGTAGGAAGGAGCAGGG - Intronic
921036777 1:211387072-211387094 TCATTTGTGAGGGAGGAGATTGG - Intergenic
921993748 1:221395392-221395414 GCAATTTCCAGGCATGAGCTAGG - Intergenic
922140764 1:222884094-222884116 TCAGTTATCTGGCAGGAGTTTGG - Intronic
922952597 1:229571552-229571574 TGATATTTCAGGCAGGACATGGG - Intergenic
923195594 1:231663575-231663597 TCAGATTTCAGGCAGGAGGGTGG - Intronic
924124834 1:240839686-240839708 TCATTGTTCACTCAGGATCTGGG - Intronic
924548370 1:245051429-245051451 TTATTTTGCAGCCAGAAGCTTGG + Intronic
1062932875 10:1364027-1364049 TCATTTCTCAGGCCTGACCTGGG - Intronic
1064415687 10:15147306-15147328 CCATTTTCCATGCAGGAACTTGG - Intronic
1064614929 10:17142918-17142940 ACACTTTTCAGGGAGGAGCAGGG + Intronic
1069501323 10:68955901-68955923 TCATTTATCAGGCTGGGGCTAGG + Intergenic
1071289266 10:84176865-84176887 TCATTTATGAGCCAGGAGCCTGG + Intronic
1071387495 10:85136700-85136722 TCAGTTTTCAGGAAGGAACAAGG - Intergenic
1071905236 10:90166125-90166147 TGATTTTTGAGGCAAGAGATAGG + Intergenic
1072458974 10:95602424-95602446 TTATTTTTCAGTCTGGAGATTGG + Intergenic
1072769682 10:98127151-98127173 TCTTTTTTCAGTCAGGAGATTGG - Intergenic
1073298084 10:102453201-102453223 TCCTTTTGAAGGCAGGTGCTGGG + Intergenic
1075323246 10:121509532-121509554 TCATTATCCAGGCACGATCTTGG + Intronic
1076253918 10:129005015-129005037 TCAGGTGTCAGGCAGGAGATAGG + Intergenic
1078476206 11:11632605-11632627 TCATTTAGCAGGGAGGAGCTGGG + Intergenic
1078494298 11:11800560-11800582 TCATTTTTCATACAGAAGCCAGG - Intergenic
1080224662 11:29947274-29947296 TAATTTGACAGGCAGGGGCTAGG + Intergenic
1080681222 11:34477944-34477966 GGAGTTTTCAGGCAAGAGCTTGG - Intergenic
1080774097 11:35369790-35369812 TATGTATTCAGGCAGGAGCTGGG + Intronic
1081194091 11:40140067-40140089 TTATTATTAAGGCAGGAACTGGG - Intronic
1082260886 11:50075637-50075659 GCCATTTTGAGGCAGGAGCTGGG + Intergenic
1083502397 11:63122318-63122340 CCATCTTTCAGACAGTAGCTCGG - Intronic
1083512078 11:63218877-63218899 TTATCTTTCTGGCAGTAGCTAGG - Intronic
1084126574 11:67103013-67103035 TCATTTTTCAAGCAGTTACTGGG + Intergenic
1085254390 11:75164227-75164249 TGAGGTTTCAGGCAGGCGCTGGG - Intronic
1085316158 11:75546286-75546308 TCCTCTGTCAGGCATGAGCTGGG + Intergenic
1085808259 11:79656873-79656895 TCATTTTACAGGCTGATGCTGGG - Intergenic
1086174867 11:83879026-83879048 TCATTTTTTAGGCAACAGTTTGG - Intronic
1087287666 11:96282386-96282408 TTATTTTTCAGTAAGGAACTTGG + Intronic
1087856738 11:103101041-103101063 TCATTTTTCAAGCATTGGCTTGG - Intergenic
1088883965 11:113992908-113992930 TCTTCTTTCATGCAGCAGCTGGG + Intergenic
1089192527 11:116663312-116663334 TTATCCTTCAGGCAGGAGTTTGG + Intergenic
1090695942 11:129242134-129242156 TTGTTTTACAGGCAGGACCTTGG + Intronic
1091440479 12:508868-508890 TTATTTTTCAGTAAGGAGCCAGG + Intronic
1092842969 12:12561555-12561577 TCAATTTTCGGACAGGGGCTCGG - Intronic
1093231032 12:16542093-16542115 GCATTTTTCAGGCAAGAGGAAGG + Intronic
1095609092 12:44106241-44106263 TCCTCTTTCAGACTGGAGCTGGG - Intronic
1096979974 12:55722956-55722978 TAATTTTTCAGGCAGCATCATGG + Exonic
1098923850 12:76327857-76327879 TCATTTTTTTGGCAGGTGATGGG + Intergenic
1100661182 12:96700758-96700780 TCATGCTTCAGGCAGATGCTTGG + Intronic
1100717223 12:97318708-97318730 TCATTTTTAAGGCAATAGATGGG - Intergenic
1101602310 12:106221372-106221394 AAATTATTCAGGCAGGAGGTAGG + Intergenic
1102245548 12:111353549-111353571 TCATCTTTCAGGCATCAGTTGGG - Intergenic
1103098698 12:118153510-118153532 TCATTCTCCACGCAGGATCTGGG - Intronic
1104988663 12:132611874-132611896 TCAGCTTTCAGGTAGCAGCTAGG + Intergenic
1106624562 13:31407136-31407158 TCACTCTTCAGGGAGAAGCTGGG + Intergenic
1106775134 13:33001614-33001636 TCATTTCTCAGGCAGCAACCAGG - Intergenic
1107157829 13:37190436-37190458 GCATTTTTGAGGTAGGAGGTAGG + Intergenic
1109164117 13:59011720-59011742 TGATATTTCAGGCAGGACATGGG - Intergenic
1109182379 13:59229323-59229345 TGGTTCTTCTGGCAGGAGCTAGG + Intergenic
1109885081 13:68531576-68531598 TCATTTTTCAGTCTGGAGGTTGG - Intergenic
1110490184 13:76094728-76094750 TCATTTTTGAAGCACTAGCTCGG + Intergenic
1111709292 13:91791345-91791367 TCATTTTCCAGGGAGCATCTAGG - Intronic
1112522509 13:100109714-100109736 CTATTTTTAAGGCAGGGGCTTGG + Intronic
1113197929 13:107830915-107830937 TCATTTTTCATGTAGGACATGGG - Intronic
1113297486 13:108975713-108975735 TCCTTTTTGAGGCAGGTGGTTGG + Intronic
1115147732 14:30245228-30245250 ACAATTTTCAGCCAGGAGGTTGG - Intergenic
1116585444 14:46697449-46697471 TAATTTGGCAGGCAGGGGCTTGG - Intergenic
1116707960 14:48327526-48327548 TCATTTTTTTGCCAGCAGCTAGG + Intergenic
1118284576 14:64460075-64460097 TCATTTGTCAGGCAGACCCTTGG + Intronic
1120166854 14:81210076-81210098 GCATTTATTAGGCAGGAGCCAGG - Intronic
1121005449 14:90487741-90487763 TATTTTTTGAGTCAGGAGCTGGG - Intergenic
1121523749 14:94604054-94604076 TCATTTTTAAAGAAGGAGCAGGG + Intronic
1122264595 14:100540738-100540760 TCATTTTGCAGGCAAGAGTGTGG - Intronic
1123539375 15:21273056-21273078 TCATTTTACAGAGAGGAGCTAGG - Intergenic
1124439705 15:29677073-29677095 TCCCTTTGCAGGCAAGAGCTGGG - Intergenic
1125351163 15:38769020-38769042 GAACTTTTAAGGCAGGAGCTTGG - Intergenic
1128129273 15:65214927-65214949 GCATGTTCCAGGCAGAAGCTTGG - Intergenic
1129580942 15:76808918-76808940 TTATTTCTCAGGGAGAAGCTAGG - Intronic
1130160965 15:81399636-81399658 ATATTTATAAGGCAGGAGCTTGG - Intergenic
1130161710 15:81407937-81407959 TCCCTTTGCGGGCAGGAGCTGGG + Intergenic
1130251182 15:82301182-82301204 CCAGTTCTCAGGCAGGTGCTAGG + Intergenic
1131451990 15:92549314-92549336 TCATGTTCCAGGCAGGAGGAAGG + Intergenic
1202947685 15_KI270727v1_random:215-237 TCATTTTACAGAGAGGAGCTAGG - Intergenic
1133059876 16:3167446-3167468 ACATTTTTCAGGGAGGGGATAGG + Intergenic
1135056608 16:19237354-19237376 ACACTTTTGAGGCAGGAGGTGGG + Intronic
1135838304 16:25849510-25849532 TTATTTTTCAGACAGGGGCTCGG + Intronic
1136265816 16:29117408-29117430 TCATTTCGCAGGCGGGAGCTGGG + Intergenic
1136668061 16:31831729-31831751 TCACTGTTCAGGAAGAAGCTGGG - Intergenic
1136673428 16:31877969-31877991 TCGATTTACAGGCAGTAGCTTGG + Intronic
1138155437 16:54698683-54698705 TCATTTCTAAAGCAGGAGATTGG + Intergenic
1138411976 16:56847726-56847748 TCCTTTTTCACTCACGAGCTGGG + Intronic
1139477306 16:67209082-67209104 TCACTTTTTTGGCAGGGGCTGGG - Intronic
1140227972 16:73093965-73093987 TAAGTTTTCAGCCAGGAGCAGGG - Intergenic
1140441877 16:74994101-74994123 TCACCTTTCAGGCATCAGCTTGG + Intronic
1141359789 16:83384765-83384787 TCACTCTTCAGGCATGCGCTTGG + Intronic
1141451057 16:84102693-84102715 CAATTTTTCAGGCAAAAGCTTGG + Intronic
1142054632 16:87985315-87985337 TCAGTTCGCAGGCGGGAGCTGGG + Intronic
1142412903 16:89925084-89925106 GCACTTGTCAGGCAAGAGCTGGG + Intronic
1144235210 17:13254084-13254106 TCCTATTTCAGGCATAAGCTAGG - Intergenic
1148733490 17:49851634-49851656 CCATTTTACAGGCCGGCGCTGGG + Intergenic
1149004450 17:51790322-51790344 TCCTGTTTCACGCAGGAGCCAGG - Intronic
1150177555 17:63076381-63076403 TCAGATTTCAGGCAGGAGGTTGG + Intronic
1151446055 17:74164813-74164835 TGACTTTTCAGTCAAGAGCTGGG - Intergenic
1152431704 17:80251933-80251955 ACATTTTTCATGCAGAAGGTTGG + Intronic
1156652635 18:39242930-39242952 TTTTTTTTAAGACAGGAGCTGGG - Intergenic
1157273471 18:46294104-46294126 TCTCCTTTCAGGCTGGAGCTGGG + Intergenic
1157660905 18:49442831-49442853 TCATTCTTCAGGCAGCACATAGG - Intronic
1158902361 18:61976150-61976172 TCATTTTTCTGGTAGCAGGTTGG + Intergenic
1159283344 18:66315943-66315965 ACATTTTTCAGACTGGATCTTGG + Intergenic
1159725326 18:71950950-71950972 GCATTATTCAGGCAGGAACTGGG + Intergenic
1161236891 19:3202637-3202659 TCCTGGTTCAGGCAGGAACTTGG + Intronic
1161251287 19:3281697-3281719 TCAGGGTTCAGTCAGGAGCTGGG - Intronic
1161437153 19:4270517-4270539 CCCTTTTTCAGGCAGGATCTTGG - Intergenic
1162884227 19:13684448-13684470 TGATTTTTCAGGCTGAAGTTGGG - Intergenic
1166789696 19:45391561-45391583 TCCTGTTTCAGGCAGAACCTGGG - Intronic
925590290 2:5502575-5502597 TGAGTTTTCAGGAAGAAGCTGGG - Intergenic
925783812 2:7408707-7408729 TCATTTTCCAAGCTGGTGCTAGG + Intergenic
927837171 2:26408409-26408431 TCATATTCCAGGCAGGAGGCTGG + Intronic
928088602 2:28360564-28360586 TGCTGTTTCAGGCAGGAGGTGGG + Intergenic
928320251 2:30277671-30277693 TGATTTTTAAGGCATGAGGTGGG - Intronic
928429672 2:31206883-31206905 TCATTTGTCAGGCTTGAGGTAGG + Intronic
930940127 2:57002101-57002123 ACATTTTTCATGAAGGAGCAGGG - Intergenic
931723649 2:65087087-65087109 ACATTCTTCACGCAGGGGCTTGG - Exonic
932564184 2:72895225-72895247 TCTTTTTTCAGTGAGGAGCTGGG + Intergenic
933291303 2:80441345-80441367 TCATTTTTCAGGAAGGAGTAGGG + Intronic
933399005 2:81767332-81767354 TCATTTTTCAGCCACATGCTAGG - Intergenic
935482060 2:103602537-103602559 TCAGTTTTCAAGCAGAATCTGGG - Intergenic
936563165 2:113559792-113559814 TCATTTCTGAGACAGGAGATGGG + Intergenic
936873922 2:117165603-117165625 TCATGTTCCAGGCAGGAGGAAGG + Intergenic
936981085 2:118266080-118266102 GCATTCTTCAGGCTGGTGCTAGG + Intergenic
937430360 2:121832836-121832858 TCATTTTTCAGGCAGCTTCGAGG - Intergenic
937675167 2:124582210-124582232 TCATTTTGCAGGCATGTGGTTGG + Intronic
939215914 2:139238260-139238282 TCATGATGCAGACAGGAGCTGGG + Intergenic
939376813 2:141379613-141379635 TCATTTTTCAGGGAGAAGCTGGG - Intronic
941345062 2:164358223-164358245 TCATTATTCAGGAAGTAGCTGGG + Intergenic
941366717 2:164619365-164619387 TCATTTTTAAGCCAGGAATTGGG - Intronic
941396588 2:164981594-164981616 TCATTTTACAGAGAGGAGCTAGG - Intergenic
941884175 2:170511611-170511633 TCATTTTACAGATAGAAGCTAGG + Intronic
942986572 2:182150296-182150318 TCATTTTTCAGGCAAGAAATAGG + Intronic
943306846 2:186273418-186273440 TCATTTTTCAGCCAGGTGGGTGG + Intergenic
944298773 2:198098259-198098281 TGTTTTTTCAGGAAGGAGTTAGG - Intronic
946367399 2:219257354-219257376 TTTTTTTTGAGGCAGGATCTTGG + Intronic
948064873 2:235070135-235070157 CCATTTTTCAGGCAGGAGGAAGG + Intergenic
948074541 2:235155749-235155771 TCCATTTTCAAGTAGGAGCTCGG + Intergenic
948302379 2:236917434-236917456 TAATTTGGCAGGCAGGGGCTTGG + Intergenic
948709393 2:239816290-239816312 GCATTTTTGAGGGAGGAACTGGG + Intergenic
948899432 2:240948921-240948943 GCATTTTACACGCAGGATCTTGG + Intronic
1169270920 20:4198866-4198888 TTATTTTGCAGGCAGGTGTTAGG + Intergenic
1169282972 20:4282767-4282789 CCATATTCCAGGCAGGAGATGGG + Intergenic
1169787653 20:9377304-9377326 TCAGTTTTCAGCCAGGATTTGGG - Intronic
1171346862 20:24471554-24471576 TCCGTTTTCAGGCAGGAAATGGG - Intronic
1172309695 20:33908169-33908191 TCCTGTTTCCTGCAGGAGCTGGG + Intergenic
1172645771 20:36468378-36468400 TCATTTCTCAGGCTGCAGCCAGG + Intronic
1172952768 20:38732417-38732439 TCATTTTTGAGACAGGGTCTCGG + Intergenic
1173097436 20:40049429-40049451 TCATTATTAAGGCAGGTTCTGGG - Intergenic
1173600937 20:44294736-44294758 TAATTTGGCAGGCAGGGGCTTGG + Intergenic
1173859171 20:46270810-46270832 TGATATTTAAGGCAGGAGCTGGG + Intronic
1174134145 20:48367459-48367481 TGATTTTGGAGTCAGGAGCTGGG + Intergenic
1177129226 21:17236242-17236264 TCATTATTCAAGCAGGAAATCGG - Intergenic
1177229583 21:18302325-18302347 CCATTTTACAGGCAGAGGCTTGG + Intronic
1177550569 21:22615525-22615547 TCATTTTTCAGGGAGAAACAGGG + Intergenic
1177688477 21:24471279-24471301 ACATTTTTCAAGCAACAGCTTGG - Intergenic
1177855255 21:26393666-26393688 TCATTTCTCTCTCAGGAGCTTGG - Intergenic
1179316055 21:40245388-40245410 TCATGTGTCAGAGAGGAGCTAGG - Intronic
1183094281 22:35542767-35542789 TCATCTTTCAGGCAGGCCCTGGG + Intronic
1183455470 22:37920476-37920498 ACTTTTTACAGGCCGGAGCTGGG + Intronic
1184751804 22:46490574-46490596 CCACTTTTCAAGCAGGACCTGGG + Intronic
1184904606 22:47472563-47472585 TAATTTGGCAGGTAGGAGCTTGG - Intronic
949420951 3:3865042-3865064 TAAGTTTCCAAGCAGGAGCTGGG - Intronic
950212915 3:11137014-11137036 TAACTTGTCAGGCAGGAGCTGGG - Intergenic
950859579 3:16135852-16135874 GCACTTTTCAGGCATGAGCTAGG + Intergenic
951712470 3:25598700-25598722 ACATTTTTCAGGCTAGAACTTGG - Intronic
952314843 3:32223688-32223710 TCATGGTCCAGCCAGGAGCTGGG + Intergenic
953867640 3:46597944-46597966 TCATTTAACAGGGAGGAGGTAGG - Intronic
955103295 3:55872835-55872857 CCATATTTCAGGAAAGAGCTGGG + Intronic
955314976 3:57930708-57930730 TAATTTTTAAGTCAGGAGCAAGG - Intergenic
955868710 3:63414078-63414100 TTCTTTCTCAGGCAGTAGCTTGG + Intronic
956169869 3:66424411-66424433 TCAACTCTCAGGCAGGAGGTGGG - Intronic
957156796 3:76553937-76553959 TCATTCTTCATGCAAGAACTTGG + Intronic
957649566 3:82982349-82982371 TAATTTGGCAGGCAGGGGCTAGG - Intergenic
960317915 3:116200876-116200898 GAATTTTGCAGACAGGAGCTTGG - Intronic
961830820 3:129622239-129622261 TTGTTTTTCAGGCAGGATCTGGG - Intergenic
961906938 3:130272649-130272671 TAATTTCTCAGGCAAGAGCCAGG + Intergenic
962825767 3:139100078-139100100 TCAGTGTGCAGGCTGGAGCTAGG + Intronic
962929665 3:140024578-140024600 TCAGGCTGCAGGCAGGAGCTGGG + Intronic
963242044 3:143015150-143015172 CCATTTTTCATGTAGGAGATTGG - Intronic
963791618 3:149588746-149588768 TCATTTTTTAAGCAGGAAATGGG - Intronic
967428996 3:189360306-189360328 TCATTGGTCATACAGGAGCTAGG - Intergenic
968916440 4:3498937-3498959 TGATTCTGCAGGCAGCAGCTGGG - Intronic
969284374 4:6193655-6193677 TCATTTTCCAAGCAAGAGCATGG - Intronic
969918097 4:10509963-10509985 TCATGCTTCAGTCAGGAGATGGG - Intronic
969950593 4:10831339-10831361 CCATTTTCCAGGCAGAAGCCCGG + Intergenic
969956994 4:10900866-10900888 TCGTTTTTCAGTCATAAGCTTGG - Intergenic
971379194 4:26081352-26081374 CCATTTTGGAGGCAGGAGCAAGG - Intergenic
975554161 4:75643801-75643823 TGATGTTTCAGGCAGGAGTGGGG - Exonic
975707205 4:77122924-77122946 TAATTTGGCAGGCAGGGGCTTGG - Intergenic
978635986 4:110807739-110807761 TCATTTTTCTGGGAGTAGATAGG + Intergenic
979541800 4:121892066-121892088 TAATTTAACAAGCAGGAGCTGGG + Intronic
979848061 4:125542279-125542301 TTCATTTTCAGTCAGGAGCTGGG - Intergenic
980888689 4:138790708-138790730 TCATTTTTCATGCTTGACCTTGG - Intergenic
982264275 4:153524056-153524078 TCAGTTCTCAGCCAGGAGATTGG - Intronic
982476553 4:155858993-155859015 TCATTTTACAGTAAGGATCTTGG + Intronic
986025757 5:3849136-3849158 TGATTTTTCAGGCAGCCTCTGGG + Intergenic
986043467 5:4015635-4015657 TTGTTCTTCAGGCAGGATCTGGG - Intergenic
987014304 5:13801578-13801600 TCATTTCTCAGGAGGGAGGTTGG - Intronic
987212253 5:15694750-15694772 ACATTTTTAAGGCAGGAGCTGGG + Intronic
987444518 5:18001244-18001266 TCACTTCTCAGGGAGAAGCTGGG + Intergenic
988218016 5:28301940-28301962 TAATTTGGCAGGCAGGGGCTAGG - Intergenic
991245137 5:64502587-64502609 CCATATTTCTTGCAGGAGCTGGG - Intergenic
991301257 5:65131609-65131631 TTTTTTTTGAGGCAGGATCTCGG + Intergenic
991653904 5:68883670-68883692 TCATCTTTCAGGGAGAAGGTGGG - Intergenic
992771231 5:80050327-80050349 TAATTTTGCAGGTAGGGGCTTGG + Intronic
993101315 5:83543318-83543340 TCTTTTTGCAGGTAGCAGCTAGG - Intronic
994276423 5:97843835-97843857 ACATTTTACAGGCAGCACCTTGG - Intergenic
994307079 5:98219063-98219085 TCAATCATCAGACAGGAGCTAGG + Intergenic
994874452 5:105398989-105399011 TCACTTCTCAGGAAGGAGGTAGG + Intergenic
994939519 5:106303904-106303926 TCACTTTTCAGACAGAAGCTTGG - Intergenic
995519664 5:112990000-112990022 TTATTTTTCAGGAAGAAACTGGG - Intronic
997371414 5:133363593-133363615 TTATTTTTAAGGCAAGAGCAAGG - Intronic
997439723 5:133900711-133900733 TAATTTGTCACGGAGGAGCTTGG - Intergenic
998433154 5:142083976-142083998 TCTTTCTTCAGGCAGGAACAGGG + Intergenic
999447781 5:151654533-151654555 TCAGTTTTCCAGCAGGATCTCGG + Intergenic
999471266 5:151857279-151857301 CCATTTTTCAATCAGGAACTTGG - Intronic
999961341 5:156759332-156759354 TCCTGTCTCAGGCAGGAGCTGGG + Exonic
1000124974 5:158235365-158235387 TCAGATTTCAGGGAGGAGCTAGG - Intergenic
1000217086 5:159170164-159170186 TCATTTTTCAGGAAGAAGAGTGG - Intronic
1000626839 5:163548417-163548439 TTAATTGTCAGGCAAGAGCTAGG - Intergenic
1001466437 5:171970902-171970924 TTGTCTTTCAGGCAGGGGCTAGG + Intronic
1005431930 6:25767443-25767465 TCATTTTTCAGGCAAAATTTGGG + Intronic
1005622237 6:27630841-27630863 ACAGTTTTCAGGCAGGCTCTGGG + Intergenic
1005813898 6:29535121-29535143 CCATTTTTCTGGCTGCAGCTTGG + Intergenic
1006644182 6:35504946-35504968 TTATTTTTGAGGCAGGGTCTTGG + Intronic
1006656589 6:35599366-35599388 TCATTTCTCAGGCCTGGGCTAGG - Intronic
1008394139 6:50987332-50987354 TAACTTTTCAGGCAGGAGAAAGG - Intergenic
1009262422 6:61510299-61510321 TTACTTTTCATTCAGGAGCTTGG + Intergenic
1009717177 6:67412696-67412718 TAATTTTGCAGGCAGGTGCTCGG - Intergenic
1010363975 6:75028444-75028466 ACATTTCTCAGGCAGGAGATTGG - Intergenic
1011129969 6:84042642-84042664 TCATCTTTCAGGGAGGGGCCTGG - Intronic
1011402463 6:86978672-86978694 TCAGTTTTCAGACAGGAGGTTGG - Intronic
1012976516 6:105786003-105786025 ACGTTTTTCAGGCAGGAGCAGGG + Intergenic
1014289143 6:119538809-119538831 TCTTTTTTCAGGCAAAAGTTGGG - Intergenic
1014397726 6:120946670-120946692 CCATTTATTAGGCATGAGCTCGG - Intergenic
1016323087 6:142869284-142869306 TCATTTTTCAGGGAAGAGGTAGG - Intronic
1017515974 6:155156131-155156153 TCATTTTTCAAGAAGCAACTTGG - Intronic
1018189706 6:161299620-161299642 TAATTTGGCAGGTAGGAGCTTGG - Intergenic
1019126419 6:169843395-169843417 TCATTCTCCAGGCAGGAGATGGG - Intergenic
1022177492 7:27885747-27885769 TAAATTTTCAGGAAGGAGATGGG - Intronic
1022206589 7:28170242-28170264 TTATTTTTCAGACAGGGTCTTGG - Intronic
1023044969 7:36202898-36202920 TCAGATGCCAGGCAGGAGCTGGG - Intronic
1023197959 7:37663106-37663128 TAATTTGGCAGGCAGGGGCTCGG - Intergenic
1023625837 7:42114366-42114388 TCGTATTTCAGGCAGGACATGGG - Intronic
1023771109 7:43557415-43557437 TCTTTTAGCAGGCAGGGGCTTGG - Intronic
1023856365 7:44186613-44186635 CCTTTTTTCAGGAAGGAGCCTGG - Intronic
1023975683 7:45028138-45028160 TCATTTTTCAACCAGGCTCTTGG - Intronic
1024417272 7:49121348-49121370 TCAGTTTTCTGGCTGCAGCTGGG - Intergenic
1024720028 7:52125847-52125869 TCAGTTTTCAGGCTGGAACAGGG + Intergenic
1025912909 7:65841846-65841868 GCCATTGTCAGGCAGGAGCTGGG - Intergenic
1029217699 7:98963289-98963311 TCTCTCTTCAGGCAGCAGCTGGG + Intronic
1031217208 7:118910354-118910376 TCATGTCTCAGGCTGGAGCAGGG - Intergenic
1031315661 7:120255149-120255171 GCAGTTTTCAGGTGGGAGCTTGG - Intergenic
1031429114 7:121644231-121644253 TCATTTTTTAAGCAGCTGCTCGG + Intergenic
1031490434 7:122381146-122381168 ACAGCTTTCAGCCAGGAGCTGGG - Intronic
1032356737 7:131218020-131218042 TAGTTTGGCAGGCAGGAGCTAGG + Intronic
1036117739 8:5977666-5977688 TCATTTCCCAGACAGGGGCTGGG - Intergenic
1036924581 8:12892057-12892079 ACAATGTTCAGGCAGGGGCTGGG + Intergenic
1037881823 8:22577236-22577258 GCATCTTTCAGGCAGGACCGTGG - Intergenic
1037957722 8:23071796-23071818 TCATTTTACAGGAAGGAGCTGGG - Intergenic
1037962064 8:23105216-23105238 TCACTTTACAGGCAGGAGCTGGG - Intronic
1037965349 8:23129718-23129740 TTATTTTACAAGAAGGAGCTGGG - Intergenic
1037969389 8:23161193-23161215 TCACTTTACAGGCAGGAGCTGGG + Intronic
1039991726 8:42493810-42493832 TCATTTTTAAGGCAGAGACTTGG - Intronic
1039991978 8:42496183-42496205 TCATACTTCCTGCAGGAGCTAGG - Intronic
1040575198 8:48645860-48645882 TTGTTTTTCAGGCATGTGCTGGG + Intergenic
1041886782 8:62818370-62818392 TCATTTTTCATTCAAGAACTAGG + Intronic
1042025488 8:64418736-64418758 TCATTTTTAAGGCACTAGATTGG + Intergenic
1044194726 8:89361123-89361145 TCATAGTTCAGGCAACAGCTTGG + Intergenic
1044816008 8:96113743-96113765 TCATCTTTCAGGTGGGACCTGGG - Intergenic
1047020558 8:120771019-120771041 TCATTTTTTACCCAGGAGGTTGG + Intronic
1047028335 8:120849134-120849156 TCATTTTTCTAAAAGGAGCTGGG + Intergenic
1047045452 8:121047800-121047822 CCAATTTTCTGCCAGGAGCTAGG + Intergenic
1047202888 8:122781510-122781532 TCATTTTTCAGGCAGGAGCTGGG - Exonic
1047782658 8:128122878-128122900 TCACTTTCCAGGCAGGAGGCAGG - Intergenic
1048300016 8:133244683-133244705 CCATTTTACAGGCAGAAACTGGG + Intronic
1048681139 8:136843006-136843028 ACATTTTTCAGGGAGCAGCAGGG - Intergenic
1049366518 8:142239434-142239456 GCATTATTCAGGAAGGGGCTAGG + Intronic
1049889568 9:55896-55918 TCATTTCTGAGACAGGAGATGGG - Intergenic
1051847553 9:21469347-21469369 TCATTTTTCCCCCAGGAGATTGG + Intergenic
1053731051 9:41057169-41057191 TCATTTCTGAGACAGGAGATGGG - Intergenic
1054695438 9:68356143-68356165 CTATTTCTAAGGCAGGAGCTGGG + Intronic
1054945949 9:70796284-70796306 CCATGTTTCAGGGACGAGCTAGG + Intronic
1056464242 9:86838342-86838364 TCATTTTTCATTCTGGAGCCTGG + Intergenic
1057741441 9:97715396-97715418 TCATTTTTGAGGCAAGGTCTTGG + Intergenic
1058167587 9:101637388-101637410 TCAGTTTACAGGTGGGAGCTAGG + Intronic
1058824258 9:108760695-108760717 CCATTTTACAGGCAGGGGCTAGG + Intergenic
1059181610 9:112219099-112219121 TCTTCTTTCAGAAAGGAGCTTGG + Exonic
1060657956 9:125385744-125385766 TCCAGTTTTAGGCAGGAGCTGGG + Intergenic
1060933714 9:127504317-127504339 TCATTTCCCAGGCAGGAGCTGGG + Intergenic
1185447122 X:264411-264433 TTATTTTTCAGACAGAATCTCGG - Intergenic
1185552015 X:990070-990092 TCATCTTCCCGGCAGGAACTAGG + Intergenic
1185721977 X:2389452-2389474 TCTGTTTCCATGCAGGAGCTTGG + Intronic
1185819809 X:3191472-3191494 TTATTTTTCAGGGAGGAATTAGG + Intergenic
1186799875 X:13082304-13082326 TCATTTTTCTGGCATGGACTTGG + Intergenic
1187089985 X:16086007-16086029 TGAAATTTCAGGCAGGAGATTGG - Intergenic
1187512332 X:19932002-19932024 TCATTTATCAGGCAGGTACAAGG + Intronic
1188194741 X:27219229-27219251 TCATTTTTCAAGCCAGAGATTGG - Intergenic
1189004248 X:36979472-36979494 TCATTTCTAAGGCAGGTGGTTGG - Intergenic
1189044673 X:37577852-37577874 TCATTTCTAAGGCAGGTGGTTGG + Intronic
1190406297 X:50091122-50091144 TCCTTTGTCAGGGAGGAACTGGG - Intronic
1193130741 X:77916957-77916979 TGATTTTTCATGAAGGAGGTGGG + Intronic
1193856646 X:86611318-86611340 TCCTTTCTCAAGCAGGAGCAAGG + Intronic
1195679668 X:107535036-107535058 TCATTTTCAAGACAGGAGGTTGG - Intronic
1196648941 X:118149108-118149130 TAATTTTAGAGGCAGGACCTAGG - Intergenic
1199582840 X:149377624-149377646 TCATTTTTCAGCCATAAACTTGG - Intergenic
1200391594 X:155951391-155951413 TCAGTTCTCAGGCTGGGGCTTGG + Intergenic
1200775504 Y:7166921-7166943 TCTTATTCCAGGCAGCAGCTGGG + Intergenic
1200893755 Y:8352670-8352692 TCCTTTATCTGGCAGGACCTAGG + Intergenic