ID: 1047202889

View in Genome Browser
Species Human (GRCh38)
Location 8:122781511-122781533
Sequence GTCATTTTTCAGGCAGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202889_1047202894 -1 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202894 8:122781533-122781555 CATTTCGCCGGTGTCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1047202889_1047202900 30 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202900 8:122781564-122781586 TTTCACTTTGTAACTTTCTGCGG 0: 1
1: 1
2: 1
3: 50
4: 463
1047202889_1047202897 2 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202889_1047202893 -4 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202893 8:122781530-122781552 TGACATTTCGCCGGTGTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1047202889_1047202895 0 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202889_1047202896 1 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202889 Original CRISPR GTCATTTTTCAGGCAGGAGC TGG (reversed) Exonic
900426202 1:2580518-2580540 ATTATTTTTGAGGCAGGATCTGG - Intergenic
901357509 1:8663995-8664017 GCCATTTTACAGGCAGGATTGGG - Intronic
906250365 1:44306496-44306518 ATCATTTTTCAGGAAGAGGCAGG + Intronic
906459244 1:46024768-46024790 GACATTTTTCAGGCCAGAGAGGG - Intronic
906568584 1:46817844-46817866 GGCAGTGGTCAGGCAGGAGCTGG + Intronic
909842097 1:80339851-80339873 GTTATTTTTAAGCCAGAAGCGGG + Intergenic
915724201 1:158006344-158006366 GACAATTTCCATGCAGGAGCAGG - Intronic
918004024 1:180525061-180525083 CTCATAATACAGGCAGGAGCAGG - Intergenic
919072048 1:192768282-192768304 GTGATTTTTCAGGAGGGAGTAGG + Intergenic
919620350 1:199858182-199858204 GTCATTTTTTAGGCAGGTGCTGG - Intergenic
920298677 1:204975373-204975395 GTCATCCTTCAGCCAGGAGACGG - Exonic
920852126 1:209635135-209635157 ATCATTTTGTAGGAAGGAGCAGG - Intronic
1062932876 10:1364028-1364050 GTCATTTCTCAGGCCTGACCTGG - Intronic
1063601568 10:7486026-7486048 GTCAATTATCAGAAAGGAGCCGG - Intergenic
1064232467 10:13541409-13541431 GTGAAGGTTCAGGCAGGAGCAGG - Intergenic
1064614928 10:17142917-17142939 TACACTTTTCAGGGAGGAGCAGG + Intronic
1064793148 10:18981861-18981883 GTTATCTTTCAGGAAGGAGATGG - Intergenic
1065842573 10:29715417-29715439 CTCATTGTTCTGGAAGGAGCAGG - Intronic
1069079471 10:64072746-64072768 GCCGTTTTTCAAACAGGAGCTGG + Intergenic
1071270016 10:83998390-83998412 GTCATTTTCCTGGAAGGAGCTGG + Intergenic
1071958683 10:90786645-90786667 GCCATTTTTCAGGAATAAGCAGG + Intronic
1072753750 10:98003209-98003231 GTCATTTTTCAGAGAGGTGATGG - Intronic
1072788735 10:98302369-98302391 GCGATTTTTCAGGAAGGAGGGGG - Intergenic
1073298083 10:102453200-102453222 GTCCTTTTGAAGGCAGGTGCTGG + Intergenic
1074687899 10:115976680-115976702 GTCATTACTGAGGCAGGAGATGG - Intergenic
1076217432 10:128707345-128707367 GTCATTTTACCTGCAGGAGTGGG - Intergenic
1078476205 11:11632604-11632626 TTCATTTAGCAGGGAGGAGCTGG + Intergenic
1080774096 11:35369789-35369811 GTATGTATTCAGGCAGGAGCTGG + Intronic
1081459291 11:43256620-43256642 GTGACTTTTCATGCAGTAGCAGG - Intergenic
1082260885 11:50075636-50075658 GGCCATTTTGAGGCAGGAGCTGG + Intergenic
1084201169 11:67559486-67559508 GTGATTATTCAGGGAGGGGCAGG - Intergenic
1084498279 11:69518493-69518515 GGCATCTTACAGGCAGGAGCAGG - Intergenic
1084548865 11:69828872-69828894 GTCAGTTTGCAGGCAGGTGTGGG - Intergenic
1091676464 12:2494389-2494411 GTCATTTCTCAGGCTGAAGTTGG - Intronic
1093268574 12:17028711-17028733 GCCATTTTGCAGGCAGAAACTGG - Intergenic
1100181824 12:92094306-92094328 TTCATTTTTCAGGCTGGATATGG + Intronic
1101489388 12:105197336-105197358 GCCATTTTTCCAGCAGAAGCAGG - Intronic
1102245549 12:111353550-111353572 GTCATCTTTCAGGCATCAGTTGG - Intergenic
1102581872 12:113894388-113894410 GTTATTTCTCAGGCTGGAGAGGG - Intronic
1102813310 12:115842532-115842554 GTCATTTTTACAGCAGGAGTAGG + Intergenic
1104182786 12:126398797-126398819 GACATCTTTCTGGCAGGAGGGGG + Intergenic
1105943685 13:25171816-25171838 GGCGTTTTTGTGGCAGGAGCAGG + Exonic
1108744476 13:53377690-53377712 GTCCCTGTTCAGGGAGGAGCAGG - Intergenic
1112710834 13:102126933-102126955 GTCATTTTACAGGTAGAATCAGG + Intronic
1117590581 14:57263918-57263940 GAGATTTTTCAGACAGGAGAAGG - Intronic
1117686415 14:58257733-58257755 CTTTTTTTTCAGGCAGTAGCAGG + Exonic
1118726807 14:68634612-68634634 GGCATTTTCCAGGCAGGGGTGGG - Intronic
1121411674 14:93752701-93752723 CTCAATTTCCAGGCAGGAGCTGG - Intronic
1121523748 14:94604053-94604075 TTCATTTTTAAAGAAGGAGCAGG + Intronic
1121661343 14:95637482-95637504 GTAATGTTTCAGGAAGGAGAAGG + Intergenic
1121801449 14:96777603-96777625 GTCATCTTTCAATCAGGAGACGG + Intergenic
1126791260 15:52223168-52223190 GTGAGATTTCAGGCATGAGCAGG + Intronic
1126879648 15:53080893-53080915 CTCATCTTTAAGGAAGGAGCTGG - Intergenic
1126881315 15:53101184-53101206 GGCCTTTTTCAGGGAGGAGAAGG + Intergenic
1127084132 15:55408714-55408736 GTCAGTTTTCATGCAGCAGATGG - Exonic
1127575198 15:60285065-60285087 GTCACTCGTCAGGCATGAGCAGG - Intergenic
1129987553 15:79931661-79931683 ACCATTTTTCTGGCAGGAGATGG + Intergenic
1132263507 15:100445919-100445941 GTCATCGTTAAGGCAGGAACAGG - Intronic
1133728341 16:8557459-8557481 GTCCTCTTTCATGCAGTAGCTGG - Intergenic
1133814529 16:9186529-9186551 GTTATTTTTGAGGCAGGGTCTGG + Intergenic
1134450142 16:14358316-14358338 GTGATGTTTGAGGCTGGAGCAGG + Intergenic
1136265815 16:29117407-29117429 CTCATTTCGCAGGCGGGAGCTGG + Intergenic
1137017538 16:35392821-35392843 GTGGTTTTTCAGCCAGGAGATGG + Intergenic
1138146239 16:54614751-54614773 CTCATTTATCACGCAGGAGATGG - Intergenic
1138456476 16:57123966-57123988 GCCATTTTTCAGGCCTGAGGAGG + Intronic
1138479497 16:57292773-57292795 GTCATTGTTTAGGGTGGAGCTGG + Intergenic
1140227973 16:73093966-73093988 TTAAGTTTTCAGCCAGGAGCAGG - Intergenic
1141067466 16:80925676-80925698 TTCCTTCTTCAGGCAGGAGCGGG + Intergenic
1141521415 16:84582388-84582410 GTACTTTTTGAGGCTGGAGCAGG - Intronic
1142412902 16:89925083-89925105 GGCACTTGTCAGGCAAGAGCTGG + Intronic
1143022772 17:3925295-3925317 GTCATTTATCCGGCGGGACCCGG + Exonic
1143320737 17:6067199-6067221 GTCATTTTGCAGTCATGAGGGGG + Intronic
1144455360 17:15414181-15414203 GGCCTCTTTCAGGAAGGAGCTGG - Intergenic
1149389548 17:56175206-56175228 GTCATTTTTCAGTCTGGAAAAGG + Intronic
1149608431 17:57941304-57941326 GTCATTATTCTGTCAGGAACTGG + Intronic
1151446056 17:74164814-74164836 GTGACTTTTCAGTCAAGAGCTGG - Intergenic
1151872501 17:76845846-76845868 GTCTTTTCTCAGTCAGGACCTGG + Intergenic
1154251046 18:12745663-12745685 GTCATTTTGCATGTAGCAGCAGG + Intergenic
1154315860 18:13302936-13302958 CTCATTTTACAGTCAGCAGCAGG - Intronic
1156760221 18:40580298-40580320 GTCATTTTTCACAAAGGAACAGG + Intergenic
1156806251 18:41185755-41185777 GGCATATTTGAGGCAGGAACTGG + Intergenic
1157581846 18:48778313-48778335 GTCATTTATCAATCAGGAGGCGG + Intronic
1158204907 18:54982086-54982108 GTTAATTTCCAGGCAGTAGCTGG + Intergenic
1158234684 18:55300379-55300401 GTCATTTGGAAGGCAGGGGCAGG + Intronic
1158883292 18:61801589-61801611 GTGACATTCCAGGCAGGAGCAGG + Intergenic
1159725325 18:71950949-71950971 TGCATTATTCAGGCAGGAACTGG + Intergenic
1160347364 18:78144862-78144884 CTCATTCTCCAGCCAGGAGCCGG + Intergenic
1162119263 19:8452429-8452451 GTCATTTTCCAGGAAAGAGTAGG + Intronic
1162667321 19:12224892-12224914 GACATCTTTCCGGCAGGAGAGGG + Intronic
1166605920 19:44142304-44142326 GTCCTTTTTCAGGCTGGGGAAGG - Exonic
1166817716 19:45556913-45556935 GTCATTGCTCAGGCAGCAGGTGG - Intronic
925156892 2:1655710-1655732 GGCATGTTTCAGTCAGGAGGGGG - Intronic
927857442 2:26536317-26536339 GTCATTGTACAGCCAGGAGGGGG + Intronic
928320252 2:30277672-30277694 GTGATTTTTAAGGCATGAGGTGG - Intronic
929044865 2:37779627-37779649 GGCATTTTTCAGGCAGAATAAGG - Intergenic
930494060 2:52115866-52115888 GTCATTTTTGTGGCAGAATCTGG - Intergenic
930940128 2:57002102-57002124 AACATTTTTCATGAAGGAGCAGG - Intergenic
931637087 2:64350617-64350639 CTCATTTGTCAGGCAGGAACAGG - Intergenic
932564183 2:72895224-72895246 TTCTTTTTTCAGTGAGGAGCTGG + Intergenic
933291302 2:80441344-80441366 TTCATTTTTCAGGAAGGAGTAGG + Intronic
934650265 2:96086702-96086724 GTCATTTTTTTGGGAGAAGCTGG - Intergenic
934714770 2:96537132-96537154 GGCATATTTCAGGCAAGAGACGG - Intronic
937288662 2:120768770-120768792 GGCCTCTTTCAGGCAGGAGGAGG - Intronic
939376814 2:141379614-141379636 TTCATTTTTCAGGGAGAAGCTGG - Intronic
941345061 2:164358222-164358244 TTCATTATTCAGGAAGTAGCTGG + Intergenic
942872173 2:180748219-180748241 GTCATTTCTAAGGCATGGGCTGG + Intergenic
943301410 2:186207266-186207288 GTCATCTTCCACGCAAGAGCAGG + Intergenic
943783040 2:191846179-191846201 GTCATTTGTCAGGGAGCACCTGG - Intronic
1168865814 20:1085611-1085633 ATCATATTCCAGGCAGGAGGAGG + Intergenic
1169121565 20:3099694-3099716 TTCTTTTTTGAGGCAGGATCTGG + Intergenic
1173097437 20:40049430-40049452 GTCATTATTAAGGCAGGTTCTGG - Intergenic
1173215557 20:41079029-41079051 GTCAGTATTCAGGCAGGAGGGGG + Intronic
1173859170 20:46270809-46270831 ATGATATTTAAGGCAGGAGCTGG + Intronic
1174034781 20:47661970-47661992 GACATATTTCAGGCAGGTGGCGG + Intronic
1174397064 20:50253226-50253248 GCCATTTTTCAGACAGGATCGGG + Intergenic
1174941818 20:54937854-54937876 GTTATTTTTCTGGCAGTAACAGG - Intergenic
1175667712 20:60874248-60874270 GGCATTCTTCTGGCAGGAACTGG + Intergenic
1177550568 21:22615524-22615546 TTCATTTTTCAGGGAGAAACAGG + Intergenic
1182583483 22:31329046-31329068 GCCATTTTTGAGCCAGGAGGGGG - Intronic
1182653529 22:31871518-31871540 GTCATTTCAGAAGCAGGAGCAGG + Intronic
1183094280 22:35542766-35542788 TTCATCTTTCAGGCAGGCCCTGG + Intronic
1183239912 22:36650037-36650059 GCCATTGTCCAGGCAGGAGTTGG - Intronic
1185080739 22:48708173-48708195 GTGATTTTGCAGGCTGGAGGAGG + Intronic
949933717 3:9100523-9100545 GTGATTTTTCAAGCAGCAGGAGG - Intronic
950212916 3:11137015-11137037 GTAACTTGTCAGGCAGGAGCTGG - Intergenic
950406530 3:12808544-12808566 GACATTTTTCTGGCCAGAGCAGG - Intronic
950892601 3:16417651-16417673 GTCATTCTCCAGGCAGGGGAAGG + Intronic
951873582 3:27394759-27394781 TTCACTTTTCAGAAAGGAGCTGG - Exonic
951985006 3:28609351-28609373 GTCATTTTTAAGGGAGCAACTGG + Intergenic
954104067 3:48399634-48399656 GTCAGTTTCCTGCCAGGAGCTGG + Intronic
956350074 3:68324843-68324865 GTCACTTTTTAGGCAGGAAAGGG + Intronic
961061141 3:123830313-123830335 GTTTTCTTTCAGGCAGTAGCAGG + Intronic
961830821 3:129622240-129622262 TTTGTTTTTCAGGCAGGATCTGG - Intergenic
963266902 3:143248977-143248999 GTCTGTTTTCATGCAGCAGCCGG + Intergenic
966294382 3:178402017-178402039 GTCAATTGTCAGGCAAGAGATGG + Intergenic
969405175 4:6986988-6987010 GTGATCTTTAAGGCAGAAGCTGG + Intronic
971553401 4:27981031-27981053 GTCATCATTAAGGCAGGAACAGG - Intergenic
975554162 4:75643802-75643824 CTGATGTTTCAGGCAGGAGTGGG - Exonic
976234904 4:82886672-82886694 GGCAGTTTTCATGGAGGAGCTGG - Intronic
977324228 4:95554540-95554562 TTCACTTTTCAGGCAGAAGAAGG + Intergenic
978307160 4:107342454-107342476 TTCTTTTTTGAGGCAGGATCTGG - Intergenic
980078798 4:128322012-128322034 CTCATTTTCCAGGCAAGATCAGG + Intergenic
981473739 4:145166549-145166571 TTCATGTTTCAGGCAGGATGTGG + Intronic
982669560 4:158304127-158304149 GTCACTTTGCAGGGAGGAGATGG + Intergenic
983786467 4:171736873-171736895 TGCATTTTCCAGGCAGCAGCAGG - Intergenic
986041350 5:3996973-3996995 TTCATATTTCATGCTGGAGCGGG - Intergenic
986043468 5:4015636-4015658 GTTGTTCTTCAGGCAGGATCTGG - Intergenic
986618454 5:9644486-9644508 GCCATTTTTCAAGAAGGAGAAGG + Intronic
987212252 5:15694749-15694771 TACATTTTTAAGGCAGGAGCTGG + Intronic
988388302 5:30595030-30595052 GGAATTTTTCAGGCAACAGCAGG - Intergenic
991245139 5:64502588-64502610 GCCATATTTCTTGCAGGAGCTGG - Intergenic
992757603 5:79923229-79923251 GTGATTTTTGAGGGAGGAGAAGG + Intergenic
994015317 5:94958151-94958173 CTCATTTGTCATTCAGGAGCAGG - Intronic
994200288 5:96966866-96966888 ATCATTTTTAAGGCATGAGGGGG - Intronic
994324548 5:98434755-98434777 GTTCTTTTGCAGGCAGGGGCAGG - Intergenic
994384210 5:99110039-99110061 TTTATTTTTCATACAGGAGCTGG + Intergenic
994952910 5:106487790-106487812 GTCATTTTTCAGACAGAAGTAGG + Intergenic
998433153 5:142083975-142083997 TTCTTTCTTCAGGCAGGAACAGG + Intergenic
999961340 5:156759331-156759353 TTCCTGTCTCAGGCAGGAGCTGG + Exonic
1000869771 5:166561484-166561506 TTCATTTTTGAGGCAGGAAGTGG + Intergenic
1001402545 5:171454252-171454274 GCCATTTTCCAGGCAGTGGCAGG + Intronic
1001651014 5:173316406-173316428 ATCCTTTCTCAAGCAGGAGCTGG - Exonic
1004837686 6:19546808-19546830 GTCATTTTTAAGGCAGTTGTTGG - Intergenic
1005948463 6:30613162-30613184 TTCATTTTGAAGGCAGGAGTTGG - Intronic
1007254662 6:40520416-40520438 GTCATTTCTGGGGCTGGAGCAGG + Intronic
1008139186 6:47812186-47812208 GCCATTTTTCATGCTGGAGGAGG + Intronic
1008446308 6:51595928-51595950 TTCATTCCTCAGGGAGGAGCTGG + Intergenic
1008962233 6:57277607-57277629 CTCATTTTCCAAGCAGAAGCAGG - Intergenic
1010451439 6:76008259-76008281 GTCTTTTTTCATGCACAAGCAGG - Intronic
1010602299 6:77844820-77844842 ATCATTTTTCTGGGAGGAGAGGG - Intronic
1010918335 6:81649145-81649167 GTCAGGCTTCAGGCAGGAGAAGG - Intronic
1012976515 6:105786002-105786024 AACGTTTTTCAGGCAGGAGCAGG + Intergenic
1013420600 6:109963112-109963134 GCAAGTTTTCAGGAAGGAGCAGG + Intergenic
1014289144 6:119538810-119538832 GTCTTTTTTCAGGCAAAAGTTGG - Intergenic
1015398532 6:132762270-132762292 GTCATTTTGCATTCAGGAGAAGG - Intronic
1015928100 6:138330078-138330100 GTCATAGTTAAGGCAGGAACAGG + Intronic
1016569020 6:145492153-145492175 GCCTTTTTGCAGGCAGGAACTGG + Intergenic
1016607493 6:145948662-145948684 CTCATTCATCAGGTAGGAGCTGG - Intronic
1018511283 6:164527070-164527092 GTCCTTCTTCACGCGGGAGCAGG - Intergenic
1019126420 6:169843396-169843418 CTCATTCTCCAGGCAGGAGATGG - Intergenic
1019648026 7:2141400-2141422 ATCATGTTTCAGGCTGCAGCTGG - Intronic
1020433441 7:8136601-8136623 GCCCTTCTTCAGGCATGAGCAGG - Intronic
1024621123 7:51158678-51158700 GCCCTTTTCCAGGGAGGAGCTGG + Intronic
1024720027 7:52125846-52125868 TTCAGTTTTCAGGCTGGAACAGG + Intergenic
1025022409 7:55489965-55489987 GGCATTTTCCAGGCAGAAGGAGG + Intronic
1025912910 7:65841847-65841869 GGCCATTGTCAGGCAGGAGCTGG - Intergenic
1026923543 7:74173854-74173876 CTCCTTCTCCAGGCAGGAGCTGG - Intergenic
1027556084 7:79666467-79666489 GCCATTGTCCAGGCAAGAGCAGG + Intergenic
1029217698 7:98963288-98963310 GTCTCTCTTCAGGCAGCAGCTGG + Intronic
1029601374 7:101565430-101565452 ATACTTTTTCAGGCAGGGGCTGG + Intergenic
1030716925 7:112818922-112818944 GTCATGTTTATGGCAGAAGCAGG - Intergenic
1031217209 7:118910355-118910377 ATCATGTCTCAGGCTGGAGCAGG - Intergenic
1031465130 7:122100210-122100232 GTCATATTTCATGAAGCAGCAGG - Intronic
1034346808 7:150390396-150390418 GTCATCTTTCTGGCTGGAGAGGG + Intronic
1034887538 7:154809429-154809451 GTCACTCTTCAGCCATGAGCGGG + Intronic
1035409359 7:158626644-158626666 GTCACTCTTCAGCCAGGAGAGGG - Intergenic
1035469980 7:159103535-159103557 GTCATTTTGCAGGCAGGGAAAGG - Intronic
1036544935 8:9758783-9758805 GTAATTTATCAAGCAGCAGCAGG - Intronic
1036550213 8:9809098-9809120 GTTCTTTTGCAGGCAGGGGCAGG - Intergenic
1036728109 8:11238362-11238384 GTAATTGTCCAGGCAGGAGAAGG + Intergenic
1036924580 8:12892056-12892078 GACAATGTTCAGGCAGGGGCTGG + Intergenic
1036992383 8:13612890-13612912 ATCATTGTTCAAACAGGAGCTGG - Intergenic
1037631480 8:20660640-20660662 GACATCTTTCAGGCTGGAGGGGG + Intergenic
1037843245 8:22260592-22260614 GTCTTGTCTCAGGGAGGAGCAGG - Intergenic
1037957723 8:23071797-23071819 CTCATTTTACAGGAAGGAGCTGG - Intergenic
1037962065 8:23105217-23105239 TTCACTTTACAGGCAGGAGCTGG - Intronic
1037969388 8:23161192-23161214 TTCACTTTACAGGCAGGAGCTGG + Intronic
1038164679 8:25074004-25074026 GCCATTTTCAAGGCAGGAACTGG - Intergenic
1038880946 8:31610843-31610865 CTCAAATTTTAGGCAGGAGCAGG + Intergenic
1041281338 8:56212720-56212742 GTCAATTTACAGTGAGGAGCGGG - Intronic
1041569131 8:59316825-59316847 GTCATTTTTCATTCAGCACCTGG + Intergenic
1043617194 8:82141042-82141064 GGCATTTTTCAGGAAGCTGCTGG + Intergenic
1047149377 8:122243321-122243343 ATCATTTTTAACTCAGGAGCTGG + Intergenic
1047202889 8:122781511-122781533 GTCATTTTTCAGGCAGGAGCTGG - Exonic
1048681140 8:136843007-136843029 CACATTTTTCAGGGAGCAGCAGG - Intergenic
1049010425 8:139883742-139883764 ACCAGTTTTCAGGCAGGACCGGG + Intronic
1049231279 8:141484719-141484741 GTCTATTTTCAGGCAGGCGGTGG + Intergenic
1051809901 9:21036922-21036944 GTCCTTTCTCAGGCAGATGCAGG - Intergenic
1052083150 9:24231499-24231521 GACATATTTCATGGAGGAGCTGG + Intergenic
1052720174 9:32164630-32164652 GTCACAGTTAAGGCAGGAGCAGG + Intergenic
1054715922 9:68557624-68557646 GTATTTTTTGAGACAGGAGCTGG - Intergenic
1058705898 9:107637738-107637760 GGCATATTTAAGGCAGGATCAGG - Intergenic
1060310361 9:122454203-122454225 GTCATTTTTATCTCAGGAGCAGG - Intergenic
1060933713 9:127504316-127504338 GTCATTTCCCAGGCAGGAGCTGG + Intergenic
1061929179 9:133823669-133823691 GCCATTTTCCAGGAAGGAGTAGG - Intronic
1061988183 9:134142592-134142614 GTGATTTTACAGGAAGGAGAGGG - Intronic
1186051864 X:5604823-5604845 ATTGTTTTTCAGCCAGGAGCTGG + Intergenic
1188939248 X:36216655-36216677 ATAATTTTTCAGGTAGGGGCTGG + Intergenic
1190632490 X:52401290-52401312 TACAGTTGTCAGGCAGGAGCTGG + Intergenic
1190653533 X:52591116-52591138 TACATTCATCAGGCAGGAGCTGG - Intergenic
1190700115 X:52981487-52981509 TACATTAGTCAGGCAGGAGCTGG + Intronic
1196279195 X:113802930-113802952 GACATTCCTCTGGCAGGAGCAGG - Intergenic
1199462283 X:148098082-148098104 ATGATTTTTCAGGAAGGAGATGG + Intergenic