ID: 1047202891

View in Genome Browser
Species Human (GRCh38)
Location 8:122781521-122781543
Sequence CCGGCGAAATGTCATTTTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202891_1047202895 -10 Left 1047202891 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202891_1047202897 -8 Left 1047202891 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202891_1047202900 20 Left 1047202891 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1047202900 8:122781564-122781586 TTTCACTTTGTAACTTTCTGCGG 0: 1
1: 1
2: 1
3: 50
4: 463
1047202891_1047202896 -9 Left 1047202891 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1047202896 8:122781535-122781557 TTTCGCCGGTGTCTCCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202891 Original CRISPR CCGGCGAAATGTCATTTTTC AGG (reversed) Exonic
902899692 1:19506206-19506228 CCGGAGAAATGTCCATTTTAGGG - Intergenic
910949055 1:92625367-92625389 CCAGATAAATGTCATTTATCTGG + Intronic
911828916 1:102525404-102525426 CCGGTCAAATGTCACCTTTCAGG - Intergenic
912191427 1:107345516-107345538 CCTTTGAAATGGCATTTTTCTGG + Intronic
912580782 1:110719174-110719196 CCTGAGAAATGTCATTTTCAGGG - Intergenic
912684544 1:111751920-111751942 TCTGGGAAATGTCATTTTTCTGG - Intronic
917299065 1:173554191-173554213 GCTGCGAAATATCATCTTTCCGG - Intronic
918871920 1:189985477-189985499 CAAGCAAAATGTCATTTTTATGG + Intergenic
924104698 1:240638438-240638460 CCGGCCTAAAGTTATTTTTCGGG + Intergenic
924801714 1:247332706-247332728 CCGGGGAATGCTCATTTTTCAGG + Intergenic
1069786001 10:70988330-70988352 CAGGGGAAATGTCATCTCTCAGG - Intergenic
1074695582 10:116047393-116047415 CAGTCAAAATGTCATTTTTGAGG + Intergenic
1088228367 11:107646436-107646458 CCGGCCAAGTTTCATTTTTTAGG - Intronic
1092609764 12:10159765-10159787 CCAGCTAAATGACAGTTTTCTGG + Exonic
1093713748 12:22357146-22357168 CAGGCAAAATGTCCCTTTTCAGG - Intronic
1096152674 12:49324208-49324230 CTGGCGAGATGACATTTTGCTGG - Intronic
1096179993 12:49545362-49545384 CCGGCTAAATGTCAGTTACCTGG - Intronic
1100886204 12:99073328-99073350 CCAGGGAAATGACATTTTTATGG - Intronic
1104051855 12:125200169-125200191 CTGGGGACATGTCGTTTTTCTGG + Intronic
1108420947 13:50248879-50248901 TCGGCCAGATGTCTTTTTTCAGG + Intronic
1113519784 13:110932011-110932033 CTGTAGAAATGTCATTTTCCTGG - Intergenic
1115410103 14:33064549-33064571 CAGGCCCAATGTCATGTTTCTGG + Intronic
1116452792 14:45083829-45083851 ACGGCAAAATGTCATTTTTGGGG - Intergenic
1127070750 15:55286507-55286529 CAGGTGAAAAGTCATTTTTCTGG - Intronic
1132019107 15:98345096-98345118 TCTGGGAAATGTCATCTTTCTGG + Intergenic
1136233381 16:28900724-28900746 CCGGCGAATTGGCATCTTTGGGG + Exonic
1139772341 16:69288271-69288293 GCAGCTAAATTTCATTTTTCAGG + Intronic
1140787377 16:78355786-78355808 CCGGGGAGATGGCATTTTCCTGG + Intronic
1149325626 17:55526991-55527013 CCGAAGTAATTTCATTTTTCAGG - Intergenic
1156332678 18:36139270-36139292 TGGGCAAAATGTCATTATTCGGG - Intronic
1160235860 18:77086418-77086440 CTGGAGAAATGTTGTTTTTCAGG + Intronic
1162973988 19:14197995-14198017 CTGCCGAAATGTCACTTTTTAGG - Intronic
1165643555 19:37412115-37412137 CAGACAAAATATCATTTTTCAGG + Exonic
1168404040 19:56101590-56101612 CTAACAAAATGTCATTTTTCAGG - Intronic
931127204 2:59291558-59291580 CCTGGAAAATGGCATTTTTCTGG + Intergenic
932833274 2:75010983-75011005 CCTGGAACATGTCATTTTTCTGG - Intergenic
948828131 2:240584024-240584046 CGGGGGGAATGTCATTCTTCAGG + Intergenic
1169475286 20:5925656-5925678 CCAGCCAAAGTTCATTTTTCAGG + Intergenic
1173386019 20:42588473-42588495 CCAGCCACATTTCATTTTTCTGG - Intronic
1173713974 20:45185598-45185620 CTGGCGAATTTTTATTTTTCTGG - Intergenic
1180689491 22:17700100-17700122 GAGCAGAAATGTCATTTTTCAGG - Intronic
949861019 3:8504813-8504835 AAGGCCAAATGCCATTTTTCTGG + Intronic
952035914 3:29201091-29201113 CCTGCAAAATGGCATTTTTGTGG + Intergenic
961276578 3:125732004-125732026 CTGGCCAAATGTCATGTGTCTGG - Intergenic
964538885 3:157757050-157757072 CCGTGGAAATGGCTTTTTTCAGG - Intergenic
969735744 4:8988962-8988984 CCGGCCAAATGCCATGTGTCTGG - Intergenic
975336185 4:73178242-73178264 CCCATGAAATGTCATTTTTATGG - Intronic
977448735 4:97166349-97166371 CCTGCTAAATGACATATTTCTGG + Intergenic
986758868 5:10861893-10861915 ACTGAGAAATGTCATTTTTCTGG + Intergenic
993222020 5:85111157-85111179 TTGGCTAAATGTAATTTTTCTGG + Intergenic
1016341683 6:143068235-143068257 CCTCTGAAATGTCATGTTTCTGG + Intronic
1028368751 7:90066519-90066541 CTTGAGAAATGTCAATTTTCAGG - Intergenic
1033738489 7:144249074-144249096 CTGGTGAAATTTCCTTTTTCAGG + Intergenic
1033744562 7:144301880-144301902 CTGGTGAAATTTCCTTTTTCAGG - Intergenic
1043763246 8:84096343-84096365 CAGTCTAAATGTCACTTTTCTGG + Intergenic
1047202891 8:122781521-122781543 CCGGCGAAATGTCATTTTTCAGG - Exonic
1055903482 9:81267336-81267358 CCTGAGAAATGTCAGTCTTCAGG - Intergenic
1059953513 9:119492459-119492481 CAGAGGAAATGTGATTTTTCTGG - Intergenic
1190665388 X:52691976-52691998 CCCCCGAAATGTCTTTCTTCAGG + Intronic
1190674034 X:52766443-52766465 CCCCCGAAATGTCTTTCTTCAGG - Intronic
1197757420 X:130005528-130005550 CTGGCAAAAGGTCATTTTTTTGG - Intronic