ID: 1047202892

View in Genome Browser
Species Human (GRCh38)
Location 8:122781521-122781543
Sequence CCTGAAAAATGACATTTCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202882_1047202892 8 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202877_1047202892 27 Left 1047202877 8:122781471-122781493 CCTTGGCCAGTAACCAGCGCCTT 0: 1
1: 0
2: 0
3: 11
4: 81
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202884_1047202892 -8 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202880_1047202892 21 Left 1047202880 8:122781477-122781499 CCAGTAACCAGCGCCTTTAGGGC 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202886_1047202892 -10 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202885_1047202892 -9 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202883_1047202892 -5 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1047202881_1047202892 14 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202892 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202892 Original CRISPR CCTGAAAAATGACATTTCGC CGG Exonic