ID: 1047202895

View in Genome Browser
Species Human (GRCh38)
Location 8:122781534-122781556
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202888_1047202895 1 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202885_1047202895 4 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202882_1047202895 21 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202889_1047202895 0 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202890_1047202895 -6 Left 1047202890 8:122781517-122781539 CCTGCCTGAAAAATGACATTTCG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202886_1047202895 3 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202887_1047202895 2 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202883_1047202895 8 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202881_1047202895 27 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202884_1047202895 5 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1047202891_1047202895 -10 Left 1047202891 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1047202895 8:122781534-122781556 ATTTCGCCGGTGTCTCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type