ID: 1047202897

View in Genome Browser
Species Human (GRCh38)
Location 8:122781536-122781558
Sequence TTCGCCGGTGTCTCCGGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047202882_1047202897 23 Left 1047202882 8:122781490-122781512 CCTTTAGGGCTAGCCTCCCCCCC 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202886_1047202897 5 Left 1047202886 8:122781508-122781530 CCCCCAGCTCCTGCCTGAAAAAT 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202884_1047202897 7 Left 1047202884 8:122781506-122781528 CCCCCCCAGCTCCTGCCTGAAAA 0: 1
1: 1
2: 2
3: 38
4: 384
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202883_1047202897 10 Left 1047202883 8:122781503-122781525 CCTCCCCCCCAGCTCCTGCCTGA 0: 1
1: 0
2: 10
3: 106
4: 1045
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202885_1047202897 6 Left 1047202885 8:122781507-122781529 CCCCCCAGCTCCTGCCTGAAAAA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202890_1047202897 -4 Left 1047202890 8:122781517-122781539 CCTGCCTGAAAAATGACATTTCG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202889_1047202897 2 Left 1047202889 8:122781511-122781533 CCAGCTCCTGCCTGAAAAATGAC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202881_1047202897 29 Left 1047202881 8:122781484-122781506 CCAGCGCCTTTAGGGCTAGCCTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202888_1047202897 3 Left 1047202888 8:122781510-122781532 CCCAGCTCCTGCCTGAAAAATGA 0: 1
1: 0
2: 6
3: 32
4: 285
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202887_1047202897 4 Left 1047202887 8:122781509-122781531 CCCCAGCTCCTGCCTGAAAAATG 0: 1
1: 1
2: 4
3: 40
4: 377
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1047202891_1047202897 -8 Left 1047202891 8:122781521-122781543 CCTGAAAAATGACATTTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047202897 Original CRISPR TTCGCCGGTGTCTCCGGAGG GGG Exonic
900527122 1:3134878-3134900 CTCGCCGGGCTCTCAGGAGGTGG - Intronic
902169456 1:14598620-14598642 TTCGCCGCCGGCTCGGGAGGGGG - Intergenic
911664482 1:100538461-100538483 TTAGCCGGTGTCTCAGGGGGAGG - Exonic
1067812591 10:49441618-49441640 GCCGCCGGCGTCTCCGCAGGTGG + Intergenic
1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG + Intronic
1069944966 10:71979361-71979383 TTAGACGGAGTCTCGGGAGGGGG + Intronic
1072308443 10:94130922-94130944 TTCGTCAGTGTCACCGAAGGAGG + Intronic
1076156909 10:128211341-128211363 TCGCCCGGTCTCTCCGGAGGTGG + Intergenic
1076841436 10:133047776-133047798 TTGGCCGGTGACACTGGAGGGGG - Intergenic
1083837160 11:65278218-65278240 TTCCCCAGTGTCTATGGAGGTGG - Intronic
1113784287 13:112994326-112994348 TGTGCCGGTGTCTCGGGCGGGGG + Intronic
1132724905 16:1334296-1334318 TGGGCCGGGGTCTCCGGGGGAGG + Intronic
1134290884 16:12902210-12902232 CTCGCTGGCCTCTCCGGAGGCGG - Exonic
1135810914 16:25585971-25585993 TTCCCCGGTGTCTCTAGAGATGG + Intergenic
1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG + Exonic
1140442828 16:74999892-74999914 GTCGCCGGTGCCCCGGGAGGCGG - Exonic
1140904156 16:79396171-79396193 CTCACCTGTGTCTCAGGAGGAGG - Intergenic
1149430724 17:56594122-56594144 CTCCCCCGTCTCTCCGGAGGCGG - Exonic
1151541761 17:74768211-74768233 CTCGCTGGTGTCACTGGAGGCGG - Exonic
927484395 2:23478821-23478843 GCCGCCTGTGTCTTCGGAGGAGG + Intronic
943589782 2:189783903-189783925 CTCGCCGGTGCCTCCGAAGACGG + Intronic
945921114 2:215755464-215755486 TTCGCTGATGTCACCGGAGGTGG + Intergenic
1175286477 20:57840187-57840209 GTAGCTGGTGCCTCCGGAGGCGG - Intergenic
999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG + Exonic
1001506378 5:172283734-172283756 CTCGGCGGTGGCGCCGGAGGAGG - Exonic
1005482987 6:26272393-26272415 TGCGCCGGTGTACCTGGAGGCGG - Intergenic
1006652516 6:35563315-35563337 GTAGCCCGTGACTCCGGAGGTGG + Intergenic
1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG + Intergenic
1024797555 7:53036581-53036603 TGGGCTTGTGTCTCCGGAGGTGG - Exonic
1028987045 7:97017115-97017137 CTGGCCTGTGTCACCGGAGGGGG + Intergenic
1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG + Exonic
1037318409 8:17621095-17621117 TTCACCTGTGTCTGCCGAGGTGG - Exonic
1037826753 8:22164666-22164688 TCCAGCGGCGTCTCCGGAGGAGG + Intergenic
1040951095 8:52939761-52939783 TTCTCTGGTTTTTCCGGAGGAGG - Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1049536095 8:143183209-143183231 TCAGTCGGTGTCTGCGGAGGAGG + Intergenic
1198530738 X:137548285-137548307 CTCGCCGGTATCTCCGGGGAAGG - Intergenic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic