ID: 1047203087

View in Genome Browser
Species Human (GRCh38)
Location 8:122782429-122782451
Sequence CGTCCCGGTGGAGTCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047203087_1047203098 9 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203098 8:122782461-122782483 CTCCGCGCGTTTTGGCAGGCGGG No data
1047203087_1047203102 12 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203102 8:122782464-122782486 CGCGCGTTTTGGCAGGCGGGGGG No data
1047203087_1047203096 5 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203096 8:122782457-122782479 CCGTCTCCGCGCGTTTTGGCAGG No data
1047203087_1047203092 1 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203092 8:122782453-122782475 GGCCCCGTCTCCGCGCGTTTTGG No data
1047203087_1047203097 8 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203097 8:122782460-122782482 TCTCCGCGCGTTTTGGCAGGCGG No data
1047203087_1047203101 11 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203101 8:122782463-122782485 CCGCGCGTTTTGGCAGGCGGGGG No data
1047203087_1047203099 10 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG No data
Right 1047203099 8:122782462-122782484 TCCGCGCGTTTTGGCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047203087 Original CRISPR CGTCCCGGTGGAGTCCCCGC GGG (reversed) Intronic