ID: 1047203087

View in Genome Browser
Species Human (GRCh38)
Location 8:122782429-122782451
Sequence CGTCCCGGTGGAGTCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047203087_1047203102 12 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203102 8:122782464-122782486 CGCGCGTTTTGGCAGGCGGGGGG No data
1047203087_1047203096 5 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203096 8:122782457-122782479 CCGTCTCCGCGCGTTTTGGCAGG No data
1047203087_1047203099 10 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203099 8:122782462-122782484 TCCGCGCGTTTTGGCAGGCGGGG No data
1047203087_1047203101 11 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203101 8:122782463-122782485 CCGCGCGTTTTGGCAGGCGGGGG No data
1047203087_1047203092 1 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203092 8:122782453-122782475 GGCCCCGTCTCCGCGCGTTTTGG No data
1047203087_1047203097 8 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203097 8:122782460-122782482 TCTCCGCGCGTTTTGGCAGGCGG No data
1047203087_1047203098 9 Left 1047203087 8:122782429-122782451 CCCGCGGGGACTCCACCGGGACG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1047203098 8:122782461-122782483 CTCCGCGCGTTTTGGCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047203087 Original CRISPR CGTCCCGGTGGAGTCCCCGC GGG (reversed) Intronic
900570300 1:3355025-3355047 TGTCCCGGTGGGTTCCCCCCTGG - Intronic
910679091 1:89843996-89844018 CGCCCTAGTGGAGTCCTCGCAGG - Intronic
917904553 1:179575924-179575946 AGTCCCTGTGGAGTCGCTGCGGG + Exonic
921177320 1:212606852-212606874 CCTCCCGCTGGAGTGCGCGCAGG - Intronic
922755820 1:228096473-228096495 CTTCCTGCTGGAGTCTCCGCAGG + Intronic
1063458973 10:6203518-6203540 TGTCCCGGTGGCTGCCCCGCCGG + Intronic
1071573774 10:86711658-86711680 CGGCCCGGAGGAGGCCCCGGGGG - Intronic
1073042242 10:100615609-100615631 CCTCCCGCTGCAGGCCCCGCTGG + Intergenic
1073290495 10:102410906-102410928 GTTCCCGATGAAGTCCCCGCAGG + Exonic
1073491394 10:103855465-103855487 CGCCCCGGGGGACTCCCCGCCGG + Intronic
1075082515 10:119393325-119393347 CCTCCCGGCAGAGGCCCCGCCGG - Intronic
1076753894 10:132558112-132558134 TGTCCAGGTGGAGGCTCCGCAGG + Intronic
1080887145 11:36377284-36377306 CGTCCCGGCGGGATCCCCACTGG - Intronic
1084000139 11:66291730-66291752 CGTCCCCGAGAAGCCCCCGCTGG - Intergenic
1089365508 11:117918702-117918724 CGGCCCGGAGGTGTCCCAGCTGG + Exonic
1098288629 12:68933632-68933654 CGTCCCGCAGGAGCCCGCGCGGG - Intronic
1103964759 12:124631813-124631835 TGTCCCTGGGGAGTCCCTGCTGG - Intergenic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1136016275 16:27403116-27403138 CGTCCCAGTTGAGTCACCGAGGG - Intronic
1137502538 16:49022742-49022764 CGCCCAGGTTGAGTCACCGCCGG - Intergenic
1139509910 16:67421559-67421581 TGTCCCTGTGGAGTCACCTCTGG - Intergenic
1142429785 16:90019653-90019675 GGTCCCGGTGGTGTCCGCGGCGG - Intronic
1142474564 17:181338-181360 CGTCCGGGGGCAGGCCCCGCGGG + Exonic
1145036096 17:19541618-19541640 CGTCCACTTGGAGTCCCAGCGGG - Intronic
1145913796 17:28558476-28558498 CAACCCAGTGGAGTCCCGGCTGG - Exonic
1151867879 17:76816430-76816452 CACCCAGGTGGAGTCCCTGCAGG + Intergenic
1152742000 17:82022542-82022564 CGTCACGGCGGAGTCCAAGCCGG - Intronic
1152798666 17:82321155-82321177 CAGCCAGGTGGAGACCCCGCAGG - Exonic
1160788746 19:913187-913209 CGGCCCGGTGAAGGCCCTGCCGG - Exonic
1161288463 19:3480397-3480419 CTCCCCGGTGGAGGCCCAGCAGG - Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1165790079 19:38486058-38486080 CATCCCGCTGGAGGCCCTGCGGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
925068853 2:950856-950878 CGCCCCGGTGGAGCCCGAGCCGG + Exonic
925984599 2:9206309-9206331 CGTCCGGCTGTGGTCCCCGCAGG + Intergenic
926268031 2:11344222-11344244 GGCCCGGGTGGAGTCCCGGCCGG - Exonic
932410609 2:71545118-71545140 CGTGCCGGTGGCTTCCCCTCTGG - Intronic
937104048 2:119293967-119293989 CTGCCCGCTGGAGTCCCTGCTGG - Intergenic
938764334 2:134450351-134450373 CGGCCCAGTGGAGCCTCCGCTGG + Exonic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
1170890133 20:20369008-20369030 GGGCCCGGTGGAGGCGCCGCGGG + Exonic
1172517035 20:35542168-35542190 CCTACCGGTGGCGCCCCCGCAGG - Exonic
1176549444 21:8214884-8214906 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1176557339 21:8259113-8259135 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1176568372 21:8397918-8397940 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1176576281 21:8442148-8442170 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1180736989 22:18024521-18024543 AGCCCCGGCGGAGTCCCGGCGGG - Exonic
1203254331 22_KI270733v1_random:131206-131228 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1203262387 22_KI270733v1_random:176285-176307 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
961549334 3:127659936-127659958 CTTCTTGGTGGAGTCCCCGAAGG - Intronic
968353404 3:198080971-198080993 CGCCCCGGTGCAGCCGCCGCCGG + Intergenic
968820227 4:2844181-2844203 CGTCTTGGAGGGGTCCCCGCGGG + Intronic
972960462 4:44447477-44447499 AGCCCCGCTGGAGGCCCCGCGGG - Intronic
985506554 5:284855-284877 CGTGCAGCTGGAGACCCCGCGGG + Intronic
986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG + Intergenic
1005999739 6:30955687-30955709 TGTCCCGGCGGAGTCGCAGCGGG + Intergenic
1007573823 6:42911816-42911838 CGTCGCGGTGGGTTCCCCCCCGG - Intergenic
1017896474 6:158684491-158684513 CGTCACGGTGGAGTGCAGGCAGG + Intronic
1020279673 7:6643890-6643912 CTTCCTGGTAGAGGCCCCGCTGG - Exonic
1024925122 7:54604525-54604547 TGTCCAGGTGGAGTCCCGGAGGG - Intergenic
1026903770 7:74051249-74051271 CCTCCCAGTGGAGGCCCCGCAGG + Intronic
1035582079 8:746833-746855 CATCCCGGTGTAGCCCCTGCTGG + Intergenic
1035782260 8:2237904-2237926 AGTCCCTGGGGAGTCCACGCAGG - Intergenic
1035809856 8:2481680-2481702 AGTCCCTGGGGAGTCCACGCAGG + Intergenic
1042563170 8:70088690-70088712 CGGCTCGGTGGAGTCTCAGCGGG - Intergenic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1049636259 8:143691141-143691163 CGTCCCGGTAGAGGGCCCTCTGG - Exonic
1049846347 8:144803709-144803731 CGTCCCTGTAGAGTGCCTGCTGG - Exonic
1053503410 9:38620895-38620917 TGTCCCGGTGCAGCCGCCGCCGG + Intergenic
1057152553 9:92808373-92808395 CGTCCCTGTGCAGCCGCCGCGGG - Intergenic
1057653732 9:96936915-96936937 CGCCCCGGAGGAGACGCCGCAGG - Intronic
1060840802 9:126791876-126791898 CCTTCCTGTGGAGTCCCCGTGGG - Intergenic
1062613197 9:137384067-137384089 CTCCCCTGTGGAGTCCCTGCTGG - Intronic
1203470732 Un_GL000220v1:114350-114372 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1203478553 Un_GL000220v1:158322-158344 CCTCGCGGGGGATTCCCCGCGGG - Intergenic
1197833679 X:130672375-130672397 GGTCCTGGTGGAGTCCCTCCAGG + Intronic
1201178204 Y:11322465-11322487 CGTCCCAGGGGAGTCCGCGGTGG + Intergenic