ID: 1047214415

View in Genome Browser
Species Human (GRCh38)
Location 8:122864894-122864916
Sequence GGTCTTCTTCCCCTGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047214411_1047214415 -4 Left 1047214411 8:122864875-122864897 CCTTTGTGCTTTGTAACTGGGTC 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1047214415 8:122864894-122864916 GGTCTTCTTCCCCTGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047214415 Original CRISPR GGTCTTCTTCCCCTGGGGTC TGG Intronic
No off target data available for this crispr