ID: 1047215237

View in Genome Browser
Species Human (GRCh38)
Location 8:122870757-122870779
Sequence CTCCTTCTCTCTGGGGCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215237_1047215246 19 Left 1047215237 8:122870757-122870779 CCGATGGCCCCAGAGAGAAGGAG 0: 1
1: 0
2: 3
3: 25
4: 280
Right 1047215246 8:122870799-122870821 GTCACAGCAGAAATGGAGTGGGG No data
1047215237_1047215244 17 Left 1047215237 8:122870757-122870779 CCGATGGCCCCAGAGAGAAGGAG 0: 1
1: 0
2: 3
3: 25
4: 280
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215237_1047215243 12 Left 1047215237 8:122870757-122870779 CCGATGGCCCCAGAGAGAAGGAG 0: 1
1: 0
2: 3
3: 25
4: 280
Right 1047215243 8:122870792-122870814 CTGAGCAGTCACAGCAGAAATGG No data
1047215237_1047215245 18 Left 1047215237 8:122870757-122870779 CCGATGGCCCCAGAGAGAAGGAG 0: 1
1: 0
2: 3
3: 25
4: 280
Right 1047215245 8:122870798-122870820 AGTCACAGCAGAAATGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215237 Original CRISPR CTCCTTCTCTCTGGGGCCAT CGG (reversed) Intronic
900121521 1:1050414-1050436 CATCTTCTCCCTGGGGTCATGGG - Exonic
901113454 1:6818510-6818532 CTCCTTCTCTCTGAGGCAGGAGG - Intronic
901811438 1:11768953-11768975 CCCCTTCTCTCTTGAGCCAGTGG + Intronic
901816900 1:11799492-11799514 CTCATTCCCTCTGGGGCCACAGG - Intronic
902651576 1:17841046-17841068 GTCCTGCTCTCTGGGGTCAGAGG + Intergenic
902738644 1:18418659-18418681 CTGCTTCTGGGTGGGGCCATAGG + Intergenic
903005103 1:20293199-20293221 CTTCTTCCCTCTGGGCCCAGGGG - Intronic
903764909 1:25727865-25727887 CTCCTGCTCTCTGGTGTCCTCGG - Intronic
904528925 1:31155342-31155364 CTCCCCCTCTCCGGGGCCAGGGG - Intergenic
905314098 1:37070121-37070143 ATCCTGCTCTCTAGGGCCATGGG - Intergenic
905633097 1:39530054-39530076 CTCCTTCTCTGTGCAGCAATTGG + Intergenic
906696713 1:47828176-47828198 CTCCTTCTCTCTAGGGCTCCTGG + Intronic
907484334 1:54766658-54766680 CTCCTCCTCTTTGGGGGCAGGGG + Intergenic
907610242 1:55861954-55861976 CCCCTTCTCTTTAGGGACATGGG + Intergenic
907985866 1:59529687-59529709 CTCTTTCTCCCTGGAGGCATTGG + Intronic
910882070 1:91930777-91930799 CAACTTCTCTCTTGGTCCATAGG - Intergenic
912341402 1:108919612-108919634 CTCCTAGGCTCTGGGACCATAGG - Intronic
912687025 1:111775841-111775863 CTGCATCTCACTGGGGCCAGAGG - Exonic
915972365 1:160363670-160363692 CTCCCTTTCACTGGGGCCAGAGG + Intergenic
916082743 1:161245440-161245462 CTCCTTTTTTCTAGGCCCATGGG + Intergenic
916519706 1:165552563-165552585 CTCCTCCTCACTGTTGCCATAGG - Intronic
917723017 1:177803950-177803972 CTACCTCTCTGTGGGGCCACAGG - Intergenic
918188443 1:182148381-182148403 CTCCTCTTGCCTGGGGCCATTGG - Intergenic
919773188 1:201176113-201176135 CTCCTCCTTTCTGGGGAAATTGG - Intergenic
920381098 1:205534945-205534967 CCCCTACTCTCTGGGTCCAGTGG + Intergenic
920550524 1:206856809-206856831 CACCTTCTCACTTGGGCCAGAGG + Intergenic
920661958 1:207922874-207922896 CTCCTTCGCTCTGGGGACAAAGG + Intergenic
921049704 1:211502224-211502246 ATGCTTCTCTCTGGGGCAAGAGG + Intergenic
922468837 1:225862851-225862873 CTCCTTCTCTCCCTGGCCACAGG - Exonic
922503295 1:226111894-226111916 CTCCTGCTGCCTGCGGCCATGGG - Intergenic
922717494 1:227885047-227885069 CACCTTGTCCCTGGGACCATGGG + Intergenic
922870315 1:228897458-228897480 CTCCTTCTAGGTGGGGCCGTAGG - Intergenic
923268697 1:232335631-232335653 TTCCTCCTCTCTGGGGGCACTGG + Intergenic
923291619 1:232551655-232551677 CTCCTGCTCTCTGGGGCTGTGGG - Intronic
924945758 1:248845884-248845906 CGACTTCTCTCAGGGGCCACAGG - Intronic
1063095600 10:2906051-2906073 CTCCTTCTCTCTGCCGCACTCGG + Intergenic
1067531824 10:47079944-47079966 CTTCTTCTCTCAAGTGCCATGGG - Intergenic
1068420211 10:56781311-56781333 CCTCTTCTCTCTTAGGCCATGGG - Intergenic
1068835283 10:61546005-61546027 CTCCATCTCTCCGAGGCCCTAGG - Intergenic
1070264265 10:74887054-74887076 CACCGTCTCTCTGGGGACAGGGG + Intronic
1070793683 10:79204543-79204565 CTCTGTCTCTCTGGAGCTATGGG + Intronic
1073323506 10:102629576-102629598 CTCCTTCCCTTTGGAGCCTTTGG + Intronic
1076373357 10:129968426-129968448 CTCCTTCCCACTGGGGCCCAGGG - Intergenic
1077521523 11:3038294-3038316 CTCTATCTCTATGGGGCCATGGG - Intronic
1077854826 11:6113290-6113312 TTCCTTCTCTCTGGTGGCAGAGG - Intergenic
1079095328 11:17506246-17506268 ACCCTTCTCTCAGTGGCCATGGG + Intronic
1079311990 11:19375043-19375065 GTCCTTCTCTCTAGGCACATTGG + Intronic
1079554992 11:21749167-21749189 CTCCATCTCTCTGTGGCCATGGG + Intergenic
1081730196 11:45366513-45366535 CAGCTTCTCTCTGTGGCCTTTGG + Intergenic
1082961346 11:58921386-58921408 CTCCTTCTCTTTGGGCCCCTAGG - Intronic
1084477593 11:69397817-69397839 CTCCTCCTGACTGGGGGCATGGG - Intergenic
1084949401 11:72656414-72656436 CTCCGTCTCTCAGGAGCCTTTGG - Intronic
1085057222 11:73412255-73412277 CTCCTTCTCTCCTGGGCTCTAGG + Intronic
1085344539 11:75759574-75759596 CTCCTTCTCTCTTCTGCCTTGGG - Intronic
1085418688 11:76337228-76337250 CTGCCCCTCTCAGGGGCCATAGG + Intergenic
1087545163 11:99575764-99575786 CTCCTCCTGTCTGGTGGCATTGG - Intronic
1087702357 11:101449639-101449661 CTCCTTATCTCTGAAGACATGGG + Intergenic
1088792098 11:113235202-113235224 CTTCTTCTCCCTGGGGGCAGTGG + Intronic
1089286145 11:117409363-117409385 TTCCTTCTCTCTGGGGTCCTGGG + Intronic
1089457155 11:118632331-118632353 CTCCTTCTCTCCCAGGCCACTGG - Intronic
1089730282 11:120514781-120514803 TTCCCTCTCTCTGGTGCCTTAGG + Intronic
1091283171 11:134393865-134393887 CTCCCTCTCTTTGGGGGCACTGG - Intronic
1091303035 11:134519795-134519817 CTCCCTCTTTCTGGGCCCAAGGG - Intergenic
1092144652 12:6206101-6206123 TTCCTGCTCTCTGAGGCCATGGG - Intronic
1094630153 12:32166069-32166091 CTCCTTCTCCCTGGGACATTTGG + Intronic
1096478517 12:51923178-51923200 CTCCTTCACTCCCTGGCCATTGG - Intronic
1096503383 12:52079077-52079099 CTCCTTTTCTCAGGCCCCATAGG - Intergenic
1097766373 12:63531613-63531635 TTACTTTTCTCTGGGGCCAGTGG + Intergenic
1097782808 12:63727451-63727473 TTACTTTTCTCTGGGGCCAGTGG + Intergenic
1100564891 12:95786034-95786056 CTCCTCTTCCCTGGGGACATTGG - Intronic
1100853731 12:98739929-98739951 CTCCTTCTCCTTATGGCCATTGG + Intronic
1101465439 12:104944201-104944223 CTACTTCTCTCTGGGGATAGGGG - Intronic
1101745370 12:107537699-107537721 CTACTTCTCTTTGGGGACAGTGG + Intronic
1102956333 12:117061424-117061446 CTCCCTCTCTCCTGGGACATTGG - Intronic
1103159437 12:118716132-118716154 CTCCAACTGTCTGGGGCCACTGG + Intergenic
1103986603 12:124771770-124771792 CCCTTTCTCTCTGGGGCCTTGGG - Intergenic
1104292169 12:127480907-127480929 CTCCTTCTCTTTGGAGACAGGGG - Intergenic
1104293370 12:127489153-127489175 CTCCTTCTCTTTGGAGACAGGGG - Intergenic
1106132611 13:26952471-26952493 CCCCTTCTCTCCAGGGCCACGGG - Intergenic
1108515601 13:51199790-51199812 CTCTTGCTCTCTGAGGCCCTCGG + Intergenic
1108676063 13:52739065-52739087 CTGCTGCTCTTTGGGGCCATCGG - Exonic
1110930436 13:81209030-81209052 CTCCTTTTCTCTCTGGCTATTGG + Intergenic
1112308190 13:98294182-98294204 CTCCTTCTCACTGAGGCCTGTGG + Intronic
1112393553 13:99007451-99007473 CTGCTTCTCACTAAGGCCATGGG + Intronic
1113605540 13:111602613-111602635 CACCTTCTCTCTCGGGTCCTGGG - Intronic
1113730401 13:112637370-112637392 CTCCTCCTCCCCGCGGCCATGGG - Intergenic
1116678428 14:47935862-47935884 CTATTTCTGTCTGGGGCCACTGG - Intergenic
1117423637 14:55573275-55573297 CTCCTCCTCTCTGGGGGGTTGGG - Intronic
1118734000 14:68689517-68689539 TTCCTTCTCTCTGGGGCCTTGGG + Intronic
1118846212 14:69549544-69549566 GTCTTTCTCTCTGGGTCCACTGG - Intergenic
1118975251 14:70671122-70671144 CTTTTTCTCTCTGGGAGCATCGG - Exonic
1120680246 14:87472213-87472235 CTCCCTCTCTGCTGGGCCATGGG + Intergenic
1121401517 14:93682080-93682102 CTCCTTCTCTGGGGGCCCAGAGG - Intronic
1121979486 14:98442347-98442369 CAGCGGCTCTCTGGGGCCATTGG + Intergenic
1124441594 15:29689590-29689612 CTCTCTGTCTCTGTGGCCATGGG - Intergenic
1124673393 15:31660996-31661018 CTCCTTCCCATTGGGCCCATTGG - Intronic
1126257011 15:46639887-46639909 CTCCTTCCTTCTTGGGTCATTGG - Intergenic
1127556016 15:60088505-60088527 CTCGTTCTCCCTTGGGCCACTGG - Intergenic
1130230631 15:82094083-82094105 CTCTTGCACTTTGGGGCCATCGG - Intergenic
1132498078 16:273243-273265 CAGCTTCTCTCTGGGCCCAAGGG - Intronic
1132713411 16:1279091-1279113 CTCCTGCTCCCTGGGCCCCTCGG - Intergenic
1133085868 16:3362859-3362881 CTCTTTCTCTCTGTGGCCTGTGG - Intergenic
1136455054 16:30375755-30375777 CTCCACCTCTCTGGGGGCAATGG - Intronic
1137760272 16:50934820-50934842 CTCCATGTCTCCAGGGCCATGGG - Intergenic
1138105218 16:54284367-54284389 CTCCTGCTTTCTGCGGCCCTGGG - Intronic
1138552727 16:57756300-57756322 CTCTTTCTGTCTGTGGCCCTTGG + Intronic
1141460885 16:84178268-84178290 TTCCTTCTCCCTTGGGACATGGG - Exonic
1141550123 16:84801306-84801328 TTCCTTCTCTCTGAGCCCACAGG - Intergenic
1142130840 16:88430850-88430872 CTCATCCTCTCTGGGACCCTGGG - Exonic
1142246061 16:88970594-88970616 CCCCTTCCCTCCGGGGCCACAGG + Intronic
1142257165 16:89019644-89019666 CTTCTTCCTTCTGGGGCCTTTGG - Intergenic
1142561355 17:811314-811336 CCCCTTCTCTCTTAGGCCAGGGG - Intronic
1143356263 17:6331067-6331089 CTCCATCCCCATGGGGCCATTGG - Intergenic
1144599384 17:16599154-16599176 CTCCTCCCCTCTGCAGCCATGGG + Intergenic
1146574214 17:33977697-33977719 AACCTTCTCTTTGGGGCCAGAGG - Intronic
1147574958 17:41593665-41593687 CTCCTGCTCTCTGGGGAAAAGGG - Intergenic
1147699987 17:42387951-42387973 TTCCTGCTCCCTGGGGCCCTGGG - Intronic
1147789892 17:43007144-43007166 CTCCTCCTGTCTGAGGCAATAGG - Intronic
1147904794 17:43815973-43815995 CTCCCTAACTCTGGGGCCTTGGG + Intronic
1148887068 17:50781512-50781534 CGCCGTCTCTCTGGAGCCAAAGG + Intergenic
1149498708 17:57135495-57135517 CCCCATCTCTCTAGGTCCATAGG + Intergenic
1149679460 17:58495267-58495289 CACCTTCTCTCTGAGCCCACTGG + Exonic
1150532088 17:65994878-65994900 CTTTCTCTCTCTGGTGCCATTGG + Intronic
1151226842 17:72654279-72654301 CTTCTTCCCTCTGGGGCCCCAGG + Intronic
1151475538 17:74342703-74342725 CCCCTTACCTGTGGGGCCATAGG - Exonic
1151598796 17:75093911-75093933 TTCCCTCTCTCTGAGGCCACAGG + Intronic
1151674529 17:75590727-75590749 CCCCTTTTCTCTGGGGACAGAGG + Intergenic
1151715667 17:75829938-75829960 CTCCTCCTGGCTGGGGCCAAGGG - Intronic
1151823786 17:76512439-76512461 CTCCTACCCTCTGGGGGCCTTGG - Intergenic
1152036957 17:77879542-77879564 CACCTTCTCTGTGGGGCTCTAGG - Intergenic
1152105451 17:78326058-78326080 GTCCTGCTCTCTGGGGACACAGG - Intergenic
1152364921 17:79850028-79850050 CTGCTTCCCTCTGGGTCCTTTGG + Intergenic
1152400924 17:80065675-80065697 CCCCCTCTCTCTGGGTCCACCGG + Intronic
1154195244 18:12260947-12260969 GTCCTGCTCTGTGGGGGCATGGG + Intronic
1155250215 18:23947089-23947111 CCCCTCCTCTCTGGGGACAGAGG - Intronic
1155334798 18:24752634-24752656 TGCCTTTTGTCTGGGGCCATGGG + Intergenic
1155918163 18:31576249-31576271 CTCCATCCCTGTGGTGCCATGGG - Intergenic
1160329230 18:77977220-77977242 CCCCTTCTCTCTGGGCCCCGGGG - Intergenic
1160592989 18:79954282-79954304 CTCCTTGTTTCTGGGGCCTCTGG - Intergenic
1160727190 19:622541-622563 CTCCTCCTGGCTGGGGCCAGTGG - Intronic
1161030814 19:2056943-2056965 GTCCTTGTGTCTGGGGGCATTGG - Intergenic
1162731317 19:12720804-12720826 CTCTTTCTCTCTCTGGCCTTTGG + Intronic
1163020324 19:14478064-14478086 CTCTGTCTCCCTGGGGCCTTGGG - Exonic
1163596522 19:18224162-18224184 CTCCTCCTCTTTGGGGTCAGAGG + Intronic
1164293534 19:23888726-23888748 CTTCTTCTCACTGGGGTGATAGG + Intergenic
1164427651 19:28156606-28156628 CTCACTCTCTCTGTGGCCTTGGG + Intergenic
1165855684 19:38878331-38878353 CTCCCTCTTTCTGGGGCCTCAGG + Intergenic
1166558051 19:43714657-43714679 TCCCTTCTCTCTTGGGCCAGGGG + Intergenic
1167215579 19:48162273-48162295 CTCCGTCTCTCTGCTGCTATTGG + Exonic
1168122026 19:54256909-54256931 CTTCTTCTCACTGGGGACAAGGG - Intronic
1168125470 19:54280212-54280234 CTCCTCCTCACTGGGGACAAGGG - Intronic
1168128131 19:54298531-54298553 CTCCTGCTCACTGGGGACAACGG - Intergenic
1168134099 19:54338814-54338836 CTCCTCCTCTCTGGGGACAAGGG - Intronic
1168171784 19:54594506-54594528 CTCCTCCTCACTGGGGACAAGGG + Intronic
1168176505 19:54631336-54631358 CTCCTCCTCACTGGGGACAAGGG + Intronic
1168345289 19:55647863-55647885 CTCCTGCCTTCTGGGCCCATTGG + Intronic
1168721075 19:58555352-58555374 CTCCTTCTATCTGAGGCCTCAGG - Intergenic
925384667 2:3453693-3453715 CTCCTTTTGTCTGGGGCAAAAGG + Intronic
927490186 2:23516223-23516245 ACCCTTGACTCTGGGGCCATGGG + Intronic
927718781 2:25369797-25369819 CTCCTTCCCTGTGTGGCCCTGGG + Intergenic
930434941 2:51328927-51328949 CTCCTTCTGTTTAGGGCCACAGG - Intergenic
930617069 2:53604637-53604659 CTCCTTCTCTATGTTGACATCGG - Intronic
931127144 2:59290658-59290680 CCACTTCTCACTAGGGCCATTGG - Intergenic
934159033 2:89230593-89230615 GGCCTTCTCTCTGGGGACATAGG + Intergenic
934208242 2:89951832-89951854 GGCCTTCTCTCTGGGGACATAGG - Intergenic
934661617 2:96146240-96146262 GTACTTCTCTCTGGGGCCTGGGG - Intergenic
935627334 2:105181976-105181998 CTTCCCCTCTCTGGGACCATTGG + Intergenic
937596457 2:123680947-123680969 TTCCTTCTCTCTGGCACTATTGG + Intergenic
939658226 2:144853968-144853990 TCACTCCTCTCTGGGGCCATGGG - Intergenic
939710180 2:145507731-145507753 CTCCTACTCTCTATGTCCATAGG + Intergenic
940152190 2:150614901-150614923 CTCCTCCTCTCTGTGTCCTTGGG + Intergenic
940284673 2:152022111-152022133 CTCCTCCTCTCTTTGGCAATCGG + Intronic
944456986 2:199905361-199905383 CTCCTTTTCTCTTCTGCCATGGG + Intergenic
947361022 2:229345483-229345505 CTCCTGCTATCCAGGGCCATGGG + Intergenic
947472785 2:230413844-230413866 CACCTTTTCTGTGGGGCAATGGG - Intergenic
1169540589 20:6595336-6595358 CTCATTCTCACTGGGCCCATGGG + Intergenic
1169795168 20:9454507-9454529 CTCCTTTTCTCTTGTGCCAAAGG - Intronic
1170877838 20:20267451-20267473 CACCTTCTCTCTGCTGGCATGGG - Intronic
1171188099 20:23137649-23137671 CTCCTTCTCTCGGAGACCGTGGG - Intergenic
1171285778 20:23937215-23937237 CTCCATCTCTCAGGGCCCAGTGG - Intergenic
1172299862 20:33841733-33841755 CCCCTTCTATCTGGGGACTTAGG + Intronic
1172988204 20:39010413-39010435 TGCCTGCTGTCTGGGGCCATAGG + Intronic
1173124048 20:40320458-40320480 CTCCTTCTCCCTAGGGGGATTGG - Intergenic
1173912456 20:46680474-46680496 CTCCCTGCCTCTGGGGCAATAGG - Intronic
1175207042 20:57319028-57319050 CTCTCTCTCCCTGGGGCCAGGGG - Intergenic
1175597943 20:60250371-60250393 CTCCTTTTTTCTGGTGACATAGG - Intergenic
1177561214 21:22756639-22756661 CTCCATCACTCTGGGGAGATGGG - Intergenic
1178709817 21:34906567-34906589 CTCCATCTCTATGTGGCCTTGGG - Intronic
1179571732 21:42282548-42282570 CTCCTTCCATCTGGGACCACTGG + Intronic
1180057190 21:45365069-45365091 CTCCTACTCTCTGGGGTCCCAGG + Intergenic
1180611406 22:17100512-17100534 TTCCTTCTCACAGAGGCCATTGG - Intronic
1181103483 22:20557272-20557294 TTCCTCTTCTTTGGGGCCATAGG + Intronic
1184597755 22:45524509-45524531 ATCCCTCCCTCTGGGGCCTTGGG + Intronic
1185400368 22:50612581-50612603 CTCGGTCTCTCTGGGGCCTCAGG - Intronic
950672329 3:14534816-14534838 CTCCCGCTCTCTGGGGCCTCAGG + Intronic
951528833 3:23679925-23679947 CTCCTTCTCTGTGAGCCCCTCGG - Intergenic
953703415 3:45213707-45213729 CTGGTTCACTCTGGGGCCCTGGG - Intergenic
953962488 3:47277611-47277633 TTCAGTCTCTCTGGGGTCATTGG - Intronic
954235775 3:49256121-49256143 CTCCTTGTCTCTGGGGAGAGAGG - Exonic
954636945 3:52076127-52076149 CCCCTTGTCTCTGGTGCTATTGG + Intronic
954887625 3:53890443-53890465 TTACTTCTCTCTGGGGATATTGG - Intronic
955687789 3:61562946-61562968 CTCCCTCTCTCTGGGGGCTGGGG + Intronic
956390234 3:68764228-68764250 CTCTTTCTCTGTGGGGGTATGGG - Intronic
957216400 3:77325464-77325486 CTGCTGCTGTCTGGTGCCATGGG + Intronic
957632583 3:82736926-82736948 CTCCCTCTCACTGGAGCCAGAGG + Intergenic
958927169 3:100171414-100171436 CTCGTTCTCTGTGGAGCCAAGGG - Intronic
959425618 3:106184157-106184179 TTCCTTCTCTCTGGAGTCATTGG - Intergenic
959811783 3:110628310-110628332 CTGCTTCTATATGGGGCCACAGG - Intergenic
960030815 3:113053135-113053157 CTCTTTCTCTCTGGGCACATAGG + Intergenic
961710475 3:128824342-128824364 CTCCTGCTCTCTGGGTTCCTTGG + Intergenic
961808077 3:129503377-129503399 CTACTTCTCTCTGGTGTCAGGGG + Intronic
962365163 3:134774097-134774119 TTCCTTCTCTCTGGCCCCAGAGG - Intronic
964247531 3:154670508-154670530 CTCTTTCTCTGTGGGCACATGGG + Intergenic
966906806 3:184532157-184532179 CCCGTCCTCTCTGGGGCCAGTGG - Intronic
967903215 3:194478331-194478353 CTCTTTCTCCCTGGTGCCATTGG - Intronic
968123653 3:196143283-196143305 CTCCTTCTCTCTGTGGCTGTGGG - Intergenic
969523828 4:7694031-7694053 CTCCCTGTCTCGGGAGCCATTGG + Intronic
971935582 4:33143308-33143330 AGCCTTCTCTCTGTGGCCAAAGG + Intergenic
972173410 4:36375222-36375244 AGCCTCCTCCCTGGGGCCATGGG + Intergenic
972187002 4:36541643-36541665 ATCCTTCACTCTGTGGCCAAAGG + Intergenic
974029295 4:56761906-56761928 CCCCTTCTGGCTGGGGCCACAGG - Intergenic
976380484 4:84393099-84393121 CTCCTCCTCTCTGGAGGCAGTGG - Intergenic
977361711 4:96013867-96013889 CTCATTCTCTATGTGGCCTTGGG - Intergenic
978795327 4:112702914-112702936 CTCCTTCTCTCTCAGACCCTGGG - Intergenic
980122822 4:128745245-128745267 CTCCTTCTCCCTCTGGCCAGAGG - Intergenic
980652344 4:135734611-135734633 TTCATTTTCTCTGGGACCATTGG + Intergenic
983138976 4:164124737-164124759 CTTCTACTCTCTGTGTCCATGGG - Intronic
983467911 4:168117944-168117966 CTCCCTCACACTGGGACCATGGG + Intronic
983971105 4:173875569-173875591 CATGTTTTCTCTGGGGCCATTGG - Intergenic
984948066 4:184985368-184985390 CTCCCTCTCCCTGGGGACCTAGG - Intergenic
985409175 4:189664989-189665011 CCCTTACTCTCTGGGGCCAGCGG + Intergenic
985535959 5:465904-465926 CTCCTTCTGTCTGGGGCGGGTGG + Intronic
985544909 5:504660-504682 GTGCCTCCCTCTGGGGCCATGGG + Intronic
986858105 5:11895000-11895022 CTCCTTCTCTCTGGTCACATAGG - Intronic
997235206 5:132268489-132268511 CACCTTCCCTGTGGGGCGATAGG + Intronic
998386304 5:141758956-141758978 CTCCTCCTCTCCGGGGTCACAGG - Intergenic
998506950 5:142679709-142679731 CTTCTTCCCTCTTGGGCCTTGGG + Intronic
998753682 5:145352468-145352490 TTCCTTCTCTATGGGGCCTCGGG - Intergenic
999306193 5:150521183-150521205 CTCCTCCTGTGTGGGGCCTTGGG + Exonic
1000200177 5:159001722-159001744 TTCCTCCTCTCAGGGGCTATAGG + Intronic
1000712678 5:164600341-164600363 GTCAGTTTCTCTGGGGCCATTGG - Intergenic
1001760809 5:174206571-174206593 ATGCTTCTCTTTGGGGCCTTAGG + Intronic
1001963617 5:175895122-175895144 CTCCTCCTCTCTGAAGCAATGGG + Intergenic
1002545576 5:179941551-179941573 CTCCTTCTCTCTCGGTCTTTGGG + Intronic
1002781200 6:368103-368125 CTCCTTCTTTCTGGGGGCGCGGG - Intergenic
1006677941 6:35777261-35777283 CTCCTCCTCTCTGCTGCCCTGGG + Intronic
1008013364 6:46491355-46491377 CTCCCTCTCTCTGCCGCCGTGGG + Exonic
1010619844 6:78061022-78061044 CTCCTTCTTTTTGGGGCACTGGG - Intergenic
1010771737 6:79839870-79839892 TTCCTTCTCTTTGGGGCCAGAGG + Intergenic
1012005036 6:93703137-93703159 CTCCTCCTCTCTTGGGACAGTGG + Intergenic
1015206734 6:130649169-130649191 CTTCCTCTCTCTGGGTCCAGAGG - Intergenic
1016192578 6:141288832-141288854 GGCCTTCTCTCTGAGTCCATGGG + Intergenic
1016516138 6:144894817-144894839 TTCCTGCTCTCTGGTGTCATGGG - Intergenic
1016731578 6:147433172-147433194 CTCCTCCTCTCTGAGGTCCTGGG + Intergenic
1017244326 6:152206274-152206296 CTCCTTCTCTCGGCGGACAGTGG - Exonic
1018317449 6:162570771-162570793 CTCCTACTCTCTATGTCCATGGG - Intronic
1018672604 6:166192252-166192274 CCCCTTCTCTATGGGGTTATTGG + Intergenic
1021762234 7:23913269-23913291 CCCCTTCTCTATGTGGCCTTGGG + Intergenic
1022127081 7:27368897-27368919 CTGCTTCTCTCTGGGTCTAGGGG + Intergenic
1022415179 7:30171354-30171376 CTCTTTCTCTGGGGGGACATGGG + Intergenic
1023832901 7:44050458-44050480 CTCCTTCCCTCTGGGTGCAGGGG + Intronic
1024138779 7:46440137-46440159 CACTTTCTCTCTGGGACCACTGG - Intergenic
1024465765 7:49710153-49710175 CTCTTTCTTACTTGGGCCATGGG - Intergenic
1024563472 7:50663317-50663339 CTCCTACTCTCTGGGTCCAGAGG - Intronic
1024618157 7:51133231-51133253 CTCCTTCTCACTGGGACCCAGGG - Intronic
1025946316 7:66107599-66107621 CTGGCTCTCTCTGGGGCTATGGG - Intronic
1030069842 7:105689156-105689178 CTCCTTCTCTCTTGGCCCCAGGG - Intronic
1030524925 7:110641332-110641354 CTCCAGCACTCTGGGGCCCTAGG - Intergenic
1030974517 7:116105081-116105103 TTCCTTTTCTCTGGGGCCATAGG - Intronic
1031146149 7:117999287-117999309 CACATTCTCTTTGGTGCCATAGG + Intergenic
1032246740 7:130219801-130219823 CTGCTTCTGTATGGGGCCACAGG - Intergenic
1036456040 8:8908875-8908897 CTCCCTCACTCTGTGACCATGGG + Intergenic
1037766742 8:21776803-21776825 CACCTTCTCCTTGGGGCCTTTGG + Intronic
1038804313 8:30776525-30776547 CTCCACCTCTCCTGGGCCATCGG - Intronic
1039901763 8:41757842-41757864 GCCCTTCTCTGTGGGGCCCTGGG + Intronic
1041648850 8:60281464-60281486 CCCCTTCTCTCTCTGGCCGTTGG + Intergenic
1046623066 8:116548260-116548282 CTCCTCCTCTCTGAGTCCCTTGG + Intergenic
1047215237 8:122870757-122870779 CTCCTTCTCTCTGGGGCCATCGG - Intronic
1047644060 8:126851329-126851351 CTCCCTCTCTCTGAGCCCAGAGG + Intergenic
1047676836 8:127211873-127211895 TGCCCTCTGTCTGGGGCCATGGG - Intergenic
1048316886 8:133369442-133369464 CCCCTGCTCTCTGTGTCCATGGG + Intergenic
1048513758 8:135086334-135086356 CACCTGTGCTCTGGGGCCATGGG + Intergenic
1048784661 8:138037583-138037605 GTCCTCCTCCCTGGGGCCATGGG + Intergenic
1049605647 8:143528066-143528088 CTCACTCTCGCTGGGGCCAGGGG + Intronic
1051845975 9:21451651-21451673 CTCTTTCTCTTTCGGTCCATTGG - Intergenic
1052316749 9:27123312-27123334 GTCCTTCTCTCTGCCGTCATAGG + Intronic
1052537892 9:29770950-29770972 CTCTTTATCTCTGGGTCCAGAGG + Intergenic
1056688330 9:88784807-88784829 CTCCTTCTTTGAGGGGGCATGGG - Intergenic
1057443637 9:95098983-95099005 CTTCCACTGTCTGGGGCCATCGG + Intergenic
1057566640 9:96170966-96170988 CTCCATCTATCTGGGGTCACTGG - Intergenic
1058527770 9:105877565-105877587 CTCCTTGTCTCTGAGACCCTGGG + Intergenic
1059560371 9:115328844-115328866 CTCTATTTCTCTGGGGACATTGG + Intronic
1060734829 9:126060179-126060201 CAGCTTCTCCCTGGGGCCTTGGG - Intergenic
1060773206 9:126347550-126347572 CTGCTTCTCTCTGGGCCAGTGGG + Intronic
1061568087 9:131457623-131457645 TTCATTTTCTCTGGGGCCACTGG + Intronic
1062729564 9:138101544-138101566 CTCCCTTCCTCTGGGGCCCTCGG - Intronic
1186393409 X:9183353-9183375 CTTCTTCTTTCTGGGGCCACAGG + Intergenic
1188223967 X:27574462-27574484 TTCCTTCTCTCAGGTGCCACTGG + Intergenic
1189330632 X:40142692-40142714 CTCCTGCTCTGTGGTGACATAGG + Intronic
1189588828 X:42490242-42490264 TTCCTTCTTTCTGGGACCCTAGG + Intergenic
1192448033 X:71224818-71224840 CTCCCTCTCTCTGGGACCACTGG + Exonic
1192803719 X:74492270-74492292 CTCCTTCCCTAGGGGGCCAATGG - Intronic
1195469621 X:105218216-105218238 CTCCATCTCTCTGGAGTCACAGG + Intronic
1195726693 X:107925020-107925042 CTCCTTCTCCCTGTGTGCATTGG + Intronic
1196022939 X:111009281-111009303 CTCCTGCTCTTTGGGGGCAAAGG + Intronic
1196512807 X:116532298-116532320 CTCCTTCTCTGTGGAGCCTTGGG - Intergenic
1197048187 X:122025958-122025980 TTCCTTCTCATTGTGGCCATGGG + Intergenic
1201765108 Y:17568197-17568219 CTGCACCTCTCCGGGGCCATGGG - Intergenic
1201836444 Y:18337792-18337814 CTGCACCTCTCCGGGGCCATGGG + Intergenic