ID: 1047215238

View in Genome Browser
Species Human (GRCh38)
Location 8:122870764-122870786
Sequence AGGGTCACTCCTTCTCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215238_1047215243 5 Left 1047215238 8:122870764-122870786 CCCCAGAGAGAAGGAGTGACCCT 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1047215243 8:122870792-122870814 CTGAGCAGTCACAGCAGAAATGG No data
1047215238_1047215244 10 Left 1047215238 8:122870764-122870786 CCCCAGAGAGAAGGAGTGACCCT 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215238_1047215246 12 Left 1047215238 8:122870764-122870786 CCCCAGAGAGAAGGAGTGACCCT 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1047215246 8:122870799-122870821 GTCACAGCAGAAATGGAGTGGGG No data
1047215238_1047215245 11 Left 1047215238 8:122870764-122870786 CCCCAGAGAGAAGGAGTGACCCT 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1047215245 8:122870798-122870820 AGTCACAGCAGAAATGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215238 Original CRISPR AGGGTCACTCCTTCTCTCTG GGG (reversed) Intronic
900574794 1:3377775-3377797 TGGGCCGCTCCTTCCCTCTGTGG + Intronic
900708755 1:4097500-4097522 AGGGTCCCACCTTATCCCTGGGG - Intergenic
900881219 1:5382685-5382707 TGGGTTTCTCCTTGTCTCTGTGG + Intergenic
901755871 1:11441188-11441210 TGGCTCTCTCCTTCTCCCTGTGG - Intergenic
902176736 1:14656102-14656124 AGATTCATTCCTTGTCTCTGAGG - Intronic
904702833 1:32368336-32368358 AGGGTCCCTGCTCCTGTCTGAGG - Intronic
905880591 1:41460794-41460816 AAGGTAACTCATTCTCTTTGGGG - Intergenic
908653926 1:66367545-66367567 AGGGCCACTGCTTCTCTAAGAGG + Intronic
909713607 1:78680266-78680288 AGGGGCACACCTGATCTCTGTGG - Intergenic
911054582 1:93699150-93699172 AGGGTTATCTCTTCTCTCTGAGG - Intronic
911585780 1:99689074-99689096 GGGGTCACCGTTTCTCTCTGTGG - Exonic
912707459 1:111925558-111925580 AAGGTCACTTAATCTCTCTGGGG + Intronic
913000613 1:114576977-114576999 AGGATTAATCCTTTTCTCTGTGG - Intronic
913274250 1:117122027-117122049 AGGGACTGTCCCTCTCTCTGTGG + Intronic
915344560 1:155191357-155191379 CGGGTCCGTCCTTCTCTCCGAGG + Intronic
916269486 1:162924920-162924942 ATGAACACTCCTTCTCTCTGTGG + Intergenic
916504099 1:165412105-165412127 AGAGTGCCTCCTACTCTCTGAGG + Intronic
916795641 1:168164852-168164874 AGGCTCACAACTTCTCTCTGGGG - Intergenic
918577382 1:186079286-186079308 AGCTTAACTCTTTCTCTCTGGGG + Intronic
919884933 1:201926381-201926403 TGGCTGACTCCATCTCTCTGGGG + Intronic
920068690 1:203287393-203287415 AGGCTCCCTCCTCCTCCCTGTGG - Intergenic
1064735119 10:18374325-18374347 AGGATCAATCCCTCTCTCTTCGG - Intronic
1067292764 10:44956410-44956432 AGGGTCATTCCTTCCCTTGGAGG - Intergenic
1068561010 10:58513681-58513703 AGGGTCACGCATACTCTGTGCGG - Intronic
1069743955 10:70703155-70703177 AGGGACACCCCTTCCCTCAGGGG - Intronic
1070397220 10:76021748-76021770 CAGGTCTCTCCTTCTCTCTCTGG - Intronic
1072909617 10:99488290-99488312 ATGGTCTTTCATTCTCTCTGAGG + Intergenic
1074213423 10:111360329-111360351 TGGGTCTCTCGTTCCCTCTGTGG - Intergenic
1075398164 10:122142627-122142649 GGGATCACTGCTTCCCTCTGCGG - Intronic
1076029360 10:127144252-127144274 CACGTCACTCCTTCTTTCTGTGG + Intronic
1076886763 10:133266674-133266696 AGGGCCAGGCTTTCTCTCTGGGG - Intronic
1077389431 11:2292901-2292923 AGGGGCTCTCCTCTTCTCTGGGG - Intergenic
1078465275 11:11545708-11545730 AAGGTCAGTCCTTCACTCAGGGG + Intronic
1079171748 11:18103143-18103165 CGGTTCAGTCCTTCACTCTGGGG - Intronic
1079827557 11:25216424-25216446 ATGGTCACTGTTTCTCTCTCAGG - Intergenic
1081017822 11:37905935-37905957 AGCTTAACTCCTTCTGTCTGCGG + Intergenic
1081872054 11:46387712-46387734 AGGGACTCTCCTCCTCTCTGGGG - Intergenic
1083871133 11:65489196-65489218 AGGGTCACTTTTCCTCTCTCTGG - Intergenic
1084443171 11:69187558-69187580 AGGGTCACTCTTCCTCTCAAAGG - Intergenic
1084572972 11:69970575-69970597 AAGGTCACTCCCCTTCTCTGGGG + Intergenic
1085062393 11:73459755-73459777 AGGGTCTCTTGTTTTCTCTGAGG + Intronic
1085680080 11:78565070-78565092 TGGATCACTCCTTGTCTTTGGGG + Intronic
1085736972 11:79047435-79047457 AAGCTCACTCGTGCTCTCTGGGG + Intronic
1089706016 11:120278402-120278424 AAGGTCACTCGTTCTCACTGGGG - Intronic
1091781267 12:3215928-3215950 AGGCTCATTTCTTCTGTCTGGGG + Intronic
1092533106 12:9361533-9361555 AGGGTGTCTCCCTCTGTCTGAGG + Intergenic
1092541068 12:9420030-9420052 AGGGGCCCTGCTCCTCTCTGTGG - Intergenic
1092832662 12:12459734-12459756 AGGTTCATTCTTTCTCTTTGTGG + Intronic
1093073115 12:14727793-14727815 AGTGTCCCTCTTTGTCTCTGGGG + Intergenic
1093534222 12:20203197-20203219 AGGGTAAGGCCTTCTCCCTGTGG + Intergenic
1094511976 12:31102456-31102478 AGGGGCCCTGCTCCTCTCTGTGG + Exonic
1101312654 12:103597295-103597317 TGGGTCTATCCTTCTTTCTGAGG + Intronic
1101441574 12:104708230-104708252 AAGGTCACTCAGTCACTCTGTGG - Intronic
1101850944 12:108401817-108401839 AGTGTCACTCCTCCTCCCAGGGG - Intergenic
1103979274 12:124726067-124726089 TGGGTATCTCCTTCTCTCTCTGG + Intergenic
1104950175 12:132436457-132436479 AGGGTCTCTCCTTCTCCTTCGGG - Intergenic
1104950186 12:132436507-132436529 AGGGTCTCTCCTTCTCCTTCGGG - Intergenic
1104950267 12:132436855-132436877 AGGGTCTCTCCTTCTCCTTCGGG - Intergenic
1105599357 13:21872112-21872134 AGTGTGACTCCTTCTCTCCAGGG + Intergenic
1105830121 13:24156851-24156873 AGGTTCTCTCCTGCTCTCTTGGG + Intronic
1107419640 13:40234467-40234489 AGGCTCCCTGCTTCTATCTGAGG - Intergenic
1107460747 13:40599688-40599710 AGGGGCACTCCCTCCCTTTGAGG - Intronic
1110324723 13:74200728-74200750 AGAGTTTCTGCTTCTCTCTGTGG + Intergenic
1110758927 13:79208492-79208514 AGGTTCATTCCTTATCTATGAGG + Intergenic
1112393551 13:99007444-99007466 AAGGTCACTGCTTCTCACTAAGG + Intronic
1113079503 13:106503469-106503491 AGAGTCATTCCTTGTCTATGAGG + Intronic
1113381973 13:109812652-109812674 AGGGCCACTACTTCCCCCTGAGG - Intergenic
1113382187 13:109814031-109814053 AGGGCCACTACTTCCCCCTGAGG - Intergenic
1113425549 13:110205413-110205435 ACGGTTACTGCTTCTCTCTTCGG - Intronic
1113426966 13:110216178-110216200 AGGCTGGCTCCTTCTCCCTGAGG + Intronic
1113616237 13:111682655-111682677 CTGGTCATTCCTTGTCTCTGGGG + Intergenic
1113621705 13:111767548-111767570 CTGGTCATTCCTTGTCTCTGGGG + Intergenic
1114892333 14:26941646-26941668 AGGGGCAGCCCTTCTCTCTGTGG + Intergenic
1116187954 14:41623131-41623153 AGGGTCATTGCTTTTCTCTCAGG + Intronic
1117078958 14:52132096-52132118 AGGGTCTCTGCTTAACTCTGGGG + Intergenic
1117484133 14:56176611-56176633 AGAGTCATTCCTTATCTATGAGG - Intronic
1119898459 14:78240354-78240376 AGATTCATTCCTTCTCTATGAGG + Intergenic
1121523222 14:94600331-94600353 AGGGTGTCTCCTTATCTCTGGGG + Intronic
1122035664 14:98947411-98947433 TGGGCCACTCCATCTCTATGTGG + Intergenic
1122782873 14:104150969-104150991 AGTGTCTGTCCTGCTCTCTGGGG - Intronic
1122878732 14:104680462-104680484 AGGGCCACTCCTGACCTCTGGGG + Intergenic
1123767825 15:23499418-23499440 AGGGTCAGGCTTGCTCTCTGGGG - Intergenic
1124354452 15:28984608-28984630 AGGGTCTCTCTGTCTCTCTCTGG + Intronic
1124570452 15:30858147-30858169 AGGGTCAAGCTTGCTCTCTGGGG + Intergenic
1126558406 15:50016688-50016710 AAGGACACTCCTCCTTTCTGGGG - Intronic
1127727477 15:61764142-61764164 AGGGCCACTTATTCTGTCTGGGG - Intergenic
1129789238 15:78329745-78329767 AGGGCCACCCCTTCTCTGGGTGG + Intergenic
1130092524 15:80833002-80833024 GGGGTCTCTCTCTCTCTCTGTGG - Intronic
1130509719 15:84579350-84579372 AGCTTAACTCCTTCTCTCTCTGG + Intergenic
1132315792 15:100889451-100889473 AGGGTAAGCGCTTCTCTCTGAGG + Intronic
1132778342 16:1609520-1609542 TGGGTGCCTCCTGCTCTCTGGGG - Intronic
1133905619 16:10019724-10019746 AGGATCACTCCTTCTGACTCCGG - Intronic
1134627029 16:15729508-15729530 AGGGTCAGTGATTCTGTCTGGGG + Intronic
1136380785 16:29894349-29894371 GGGGTCACGTCTTCTCTCTCTGG + Intronic
1137002283 16:35239728-35239750 AGGCTGACTCCCTCTCTCAGAGG - Intergenic
1137011843 16:35329141-35329163 AGGCTGACTCCCTCTCTCAGAGG - Intergenic
1137016201 16:35377936-35377958 AGGCTGACTCCCTCTCTCAGAGG - Intergenic
1137018590 16:35399853-35399875 AGGCTGACTCCCTCTCTCAGAGG - Intergenic
1137493152 16:48949845-48949867 TGAGTCACTCCCTCTCCCTGGGG - Intergenic
1137875963 16:51997033-51997055 ATGGTCTCTCGTTCTCTCTGAGG + Intergenic
1138678709 16:58670167-58670189 AGGGCCACTTCTTCTCTTTCAGG - Exonic
1139277075 16:65737881-65737903 AGGCTCCCTCCCTCTATCTGGGG + Intergenic
1140125980 16:72119451-72119473 AGGGTGACTTCTTGCCTCTGGGG + Intronic
1140919179 16:79520918-79520940 ATGGTAACTCCTTCTTTCTAGGG - Intergenic
1141496142 16:84411012-84411034 AGAGTCACTCCTGCTACCTGTGG - Intronic
1141604628 16:85145775-85145797 AGCCTCACTTCCTCTCTCTGTGG - Intergenic
1141758134 16:86008352-86008374 ACGGCCACTCCTGCTGTCTGCGG + Intergenic
1141918166 16:87114975-87114997 CGGGTTGCTTCTTCTCTCTGGGG - Intronic
1143364691 17:6398777-6398799 AGGGTCTTTCCTTCTGTCTCAGG + Intronic
1143413362 17:6726378-6726400 AGGGTAAAATCTTCTCTCTGGGG - Intergenic
1143819049 17:9544531-9544553 GAGGTCACTACTTCTCTGTGTGG - Intronic
1144638391 17:16924953-16924975 GGGGTCCCTGCTGCTCTCTGAGG + Intergenic
1144682424 17:17204770-17204792 AGGATGTCTCCTTCTCTTTGGGG - Intronic
1146533439 17:33629815-33629837 AGGGTCACCGCTTCTCTCCCTGG - Intronic
1148630807 17:49106863-49106885 TGGGTCATTCCTTGTCTCTGAGG + Intergenic
1149416809 17:56468543-56468565 TGGGTCCTTCCTTCTCTCTGTGG - Intronic
1149991727 17:61387308-61387330 GGGGTCACTCTTTGTCTGTGAGG - Intronic
1150785774 17:68161785-68161807 GGGGTAACTCCTTCTCTCATGGG + Intergenic
1151025049 17:70668715-70668737 AGCTTAACTCCTTCTCTCTCAGG - Intergenic
1151426633 17:74035011-74035033 AGAGTCATTCCTTATCTATGAGG + Intergenic
1152170366 17:78742368-78742390 AGGGTCCCACCTTCTCTCCCAGG - Intronic
1152456911 17:80421991-80422013 AAGGTCCCTCCTTCCCCCTGGGG + Intronic
1152849673 17:82625586-82625608 AGGAACACTCCTTTTCTGTGTGG - Intronic
1153834478 18:8951614-8951636 AGACTCACTCCTTATCTATGAGG - Intergenic
1154973339 18:21432249-21432271 ATGGCCACTCCATCTCTCTCTGG + Intronic
1157667398 18:49499279-49499301 AAGGTCACACCTTCTTCCTGGGG - Intergenic
1158855175 18:61536498-61536520 AGGGTCACTGCTTCTATCAATGG - Exonic
1160014875 18:75133027-75133049 GAGGTCACTCAGTCTCTCTGAGG + Intergenic
1160508552 18:79440808-79440830 AGAGACACTCCTCTTCTCTGAGG + Intronic
1162857897 19:13483111-13483133 AGGTTCACTACTTCTATATGTGG + Intronic
1162859984 19:13499243-13499265 TTGGTCCCTCCCTCTCTCTGTGG - Intronic
1163054943 19:14711047-14711069 AAGAGTACTCCTTCTCTCTGAGG + Intronic
1164607735 19:29612217-29612239 AGGTTCACTCTGTCACTCTGTGG + Intronic
1164668401 19:30058611-30058633 AGAGCCTCTCCTTTTCTCTGGGG + Intergenic
1165151477 19:33763240-33763262 AGGCTTACTCCCTCCCTCTGTGG - Intronic
1165351622 19:35278940-35278962 AGGATCCCTCCTTTACTCTGGGG - Exonic
1168134103 19:54338821-54338843 TAGGTCCCTCCTCCTCTCTGGGG - Intronic
1168451784 19:56472015-56472037 AGGGACTCTCATTCTCCCTGTGG + Exonic
925360639 2:3278120-3278142 AGGCTCACTCAGTCTGTCTGTGG + Intronic
926270917 2:11365361-11365383 AGGGTCTCCCCTTTTCTCTTGGG - Intergenic
926681473 2:15667058-15667080 AGTGCCTCTCCTTCTCTCTGGGG - Intergenic
928414366 2:31079392-31079414 AGATTCACTCCTTACCTCTGAGG + Intronic
930724236 2:54667061-54667083 AGGGTCACAGGTTCACTCTGTGG - Intronic
930771488 2:55134464-55134486 AGACTCACTCCATCTCTCAGAGG + Intergenic
931643290 2:64399959-64399981 AGGGTCAGTCCTTGTCTCCTGGG - Intergenic
933992688 2:87644903-87644925 AGGCTCAGGCCTTCTCACTGCGG - Intergenic
934188891 2:89767383-89767405 AGGGCCAGCCCTTCCCTCTGTGG - Intergenic
935010051 2:99125937-99125959 AGAGGCACTCCTTCTTGCTGTGG - Intronic
935697323 2:105781434-105781456 AGGGTCACTAGTTCTGGCTGGGG - Intronic
936301167 2:111305938-111305960 AGGCTCAGGCCTTCTCACTGCGG + Intergenic
936941642 2:117890242-117890264 AGATTCATTCCTTGTCTCTGAGG + Intergenic
937641018 2:124211569-124211591 AGGACCACTCCTTCTGTCTCTGG + Intronic
938851086 2:135260047-135260069 AGGGAGCCTCCTTCTCTCTCTGG - Intronic
938922916 2:136011659-136011681 AGGCTCTCTCCTTCTATCTATGG + Intergenic
939440448 2:142242473-142242495 AGGGTCACTCCTAATCACTGGGG - Intergenic
939952132 2:148488105-148488127 GGGGTCCCTTCTGCTCTCTGAGG - Intronic
942664258 2:178300278-178300300 AGTGTCACTCCTTGTCTATGAGG - Intronic
943216609 2:185044824-185044846 ACTGTTCCTCCTTCTCTCTGTGG + Intergenic
943505102 2:188745502-188745524 AGAATCACTCCTTTTATCTGGGG - Intronic
945977547 2:216282484-216282506 AGTCTCACTCCTCCTCTCTGGGG - Intronic
946074444 2:217062290-217062312 GGGGTCTCGCCTTCTCTCTATGG - Intergenic
947198513 2:227594026-227594048 AGGGTCACTTTTTCTTTCTGTGG - Intergenic
948795595 2:240400686-240400708 AGGGACTACCCTTCTCTCTGGGG - Intergenic
948826693 2:240576514-240576536 AGGGTCACTTCTCCCCTCTAGGG + Exonic
1168820799 20:772504-772526 TGAGTCTCTCCTTTTCTCTGGGG - Intergenic
1168876586 20:1176190-1176212 TTGGTCACCCCTTCTCTCTGTGG - Intronic
1169895784 20:10503720-10503742 AGGGCCATGCTTTCTCTCTGAGG + Intronic
1173088617 20:39949196-39949218 TGGTTAACTCCTTCTTTCTGGGG + Intergenic
1173287805 20:41688878-41688900 AGGGTCAGTCCTCATCTCTTTGG + Intergenic
1174215216 20:48911299-48911321 AAGGGCCCTCCTTCTCCCTGTGG + Intergenic
1174399796 20:50269911-50269933 AGGGACTGTCTTTCTCTCTGAGG - Intergenic
1174972615 20:55293363-55293385 AGGGTCACTACCTCCCCCTGGGG - Intergenic
1175335230 20:58191563-58191585 AGACTTTCTCCTTCTCTCTGGGG + Intergenic
1179032429 21:37732201-37732223 AGGGGCCCATCTTCTCTCTGAGG - Intronic
1184540044 22:45116103-45116125 AGGGCCACCCTTTCACTCTGTGG - Intergenic
1184649516 22:45913186-45913208 AGGGACACAGCTGCTCTCTGAGG + Intergenic
1184930098 22:47674580-47674602 AGGGTCTCTCTCTCTCTCTCAGG + Intergenic
1185184985 22:49393658-49393680 AGGGGAACTCCGTCTCTCCGTGG - Intergenic
951379704 3:21968498-21968520 AGCCTCATTCCTTCTGTCTGAGG + Intronic
952784435 3:37138923-37138945 AGAGTCACTCTTGCTCTTTGGGG + Intronic
953915528 3:46918126-46918148 ATAGTCACTCCTTATCTATGGGG + Intergenic
954308827 3:49748579-49748601 AGGGTCTCTCCTTCACTCAGAGG + Intronic
955597595 3:60608483-60608505 AGGTTCAGTCCAGCTCTCTGGGG + Intronic
955846181 3:63165158-63165180 AGGGTCAGTCTTTCTGTCTTGGG - Intergenic
956825363 3:72993037-72993059 AAGGACAGTTCTTCTCTCTGTGG + Intronic
960554420 3:119011564-119011586 AGGGTTCCTCTTTCTCTCTCTGG - Intronic
962826647 3:139105349-139105371 TGGCTCCCTCCTGCTCTCTGTGG + Intronic
965737878 3:171840977-171840999 AGTGTCACTGCTTCTGTCTTGGG - Intergenic
968981311 4:3851174-3851196 AAGGCCACCCCTTCCCTCTGAGG + Intergenic
969832419 4:9808401-9808423 AGGCTGACTGCTTCTCACTGTGG - Intronic
970453239 4:16193440-16193462 AAGGTCTCTCTTTCTCTCTGTGG - Intronic
972273885 4:37539097-37539119 AGATTCACTCCTTATCTATGAGG + Intronic
973269069 4:48242547-48242569 ATGGTCCCTCCTTATCTGTGTGG - Intronic
974711655 4:65605163-65605185 AGGGTTACTCCTTTTCCCTCAGG + Intronic
979123810 4:116940485-116940507 AGAGTCACTGCTCCTCTCTTTGG - Intergenic
981803940 4:148691106-148691128 ATTGTCAATCCTTCTCTCTCTGG + Intergenic
983626573 4:169807607-169807629 AAGGTCACCCCCTCTTTCTGGGG - Intergenic
983893499 4:173056555-173056577 AGGGTCAGTTCTTCCCTTTGAGG + Intergenic
984439671 4:179750424-179750446 TGGGTAACTAGTTCTCTCTGTGG + Intergenic
984839270 4:184052919-184052941 AGAGACTCTCTTTCTCTCTGAGG + Intergenic
985535954 5:465897-465919 CAGGTCCCTCCTTCTGTCTGGGG + Intronic
985758172 5:1731467-1731489 AGGGTCACTCATCCTCCTTGAGG - Intergenic
986538092 5:8813705-8813727 AGGGTCACTAATTCTTTCAGTGG - Intergenic
989576575 5:42993358-42993380 AGGGTCACTCAGCCTTTCTGTGG - Intergenic
990137282 5:52661378-52661400 AGGGTCCATCATTCTCTCTTAGG + Intergenic
990203057 5:53399379-53399401 AGTCTCACTCCTTCTCTATCAGG + Intergenic
990967791 5:61468478-61468500 AGGGACAATCCTGCGCTCTGTGG - Intronic
993905811 5:93621543-93621565 AGGGCCACTCCCTCTCCCTCCGG + Intronic
995049691 5:107688251-107688273 AGAGAGACTCCTTCTCTTTGAGG + Intergenic
998176193 5:139903741-139903763 AGCGGCTCCCCTTCTCTCTGGGG + Intronic
999532150 5:152475844-152475866 AGGGTAACTCTGTGTCTCTGGGG + Intergenic
999547236 5:152643126-152643148 AGTGCAACTCCTTTTCTCTGGGG - Intergenic
999925625 5:156373031-156373053 ATGGCCATTCCATCTCTCTGGGG - Intronic
1001721728 5:173862466-173862488 TGTGTCTCTCCCTCTCTCTGAGG + Intergenic
1002036842 5:176477411-176477433 AGGGTTCCTCCTTCTCGCTGTGG - Intronic
1002883384 6:1272628-1272650 AGCTTCACTCTTTCTCTCTCTGG - Intergenic
1003194147 6:3900038-3900060 AGCTTCACTCTTTCTCTCTCTGG + Intergenic
1007132254 6:39486316-39486338 AGGTTCCCTCTGTCTCTCTGTGG - Intronic
1010509862 6:76704995-76705017 AGCGTCATTTCTTCCCTCTGGGG - Intergenic
1011154462 6:84314581-84314603 TAGCTCATTCCTTCTCTCTGGGG - Intergenic
1011229384 6:85142972-85142994 ACAGTCATTCCTTGTCTCTGTGG - Intergenic
1011625943 6:89283981-89284003 AGGGCCAATCTGTCTCTCTGAGG - Intronic
1012520127 6:100111186-100111208 AGGGGCAGGCCTTCTCTCTCTGG - Intergenic
1014476679 6:121881994-121882016 AGAGTCATTCATTCTCTCTTAGG - Intergenic
1014803951 6:125808293-125808315 TGGGACACTCCTTCCCTTTGAGG + Intronic
1015325976 6:131923955-131923977 AAGGTCATTGCCTCTCTCTGGGG - Intergenic
1018203351 6:161414967-161414989 AGGCTCCGTCCTTCCCTCTGAGG - Intronic
1018249880 6:161858721-161858743 AGGGTTCCTCCTCCTCTGTGGGG - Intronic
1018815709 6:167329088-167329110 AGGGCCCATCCCTCTCTCTGTGG + Intronic
1019476919 7:1248768-1248790 GGTGTCACTCCATCTCCCTGTGG + Intergenic
1019575163 7:1734252-1734274 AGGGTCATTCCTCCTCTCCCGGG + Intronic
1020097589 7:5377333-5377355 AGGGTCTCTCCCCTTCTCTGAGG - Intronic
1020208961 7:6143405-6143427 AGGGAGGCTCCTTCTCTCTTAGG + Intronic
1023598172 7:41854291-41854313 AGGCTCACTCCTTCTCTTGTAGG + Intergenic
1026535008 7:71232181-71232203 ATGCGCAGTCCTTCTCTCTGAGG + Intronic
1027136832 7:75630512-75630534 AGGCACACTCCCTATCTCTGTGG - Intronic
1029548443 7:101223583-101223605 AGGCTCACCCCTTCCCTGTGGGG - Intronic
1030313244 7:108088942-108088964 AGATTCATTCCTTATCTCTGAGG + Intronic
1030620261 7:111782152-111782174 AGGGCCACTCCTTTGCTCTGTGG + Intronic
1031136629 7:117891561-117891583 AGATTCACTCCTTATCTATGAGG - Intergenic
1031149454 7:118036218-118036240 AGGGTCTCTCATTTTGTCTGTGG + Intergenic
1031607715 7:123789900-123789922 TGGCTCACTCATTCTCTCTCTGG - Intergenic
1032491845 7:132329712-132329734 GGGTTGACTCCTTGTCTCTGGGG + Intronic
1034501020 7:151451243-151451265 AGCTTCACTCCTGCTCCCTGTGG - Intergenic
1034555798 7:151849663-151849685 AGGGTCACTGGCTCTCCCTGGGG + Intronic
1036760888 8:11507886-11507908 TGGGTGACTTCCTCTCTCTGGGG + Intronic
1047215238 8:122870764-122870786 AGGGTCACTCCTTCTCTCTGGGG - Intronic
1048327907 8:133452936-133452958 AGGGTCACCCCTGGTCACTGTGG + Intergenic
1048866570 8:138765779-138765801 AGCTTCACTCTTTCTCTCTCTGG - Intronic
1049357206 8:142194865-142194887 AGGGGCACTGCTTCTCCCCGAGG + Intergenic
1049811831 8:144578816-144578838 AGGGTCTCTCTTTGTCTCTGGGG - Intronic
1049874147 8:145004316-145004338 AGCTTCCCTCCTTGTCTCTGTGG + Intergenic
1050650112 9:7766900-7766922 ATTGTCCCTCCTTCTGTCTGGGG + Intergenic
1052851070 9:33378651-33378673 ATGGTCTCTCCTTGTCTCTGCGG - Intergenic
1056342862 9:85655110-85655132 AGGGTCACTGCTGCTTTTTGTGG - Intronic
1058279010 9:103087523-103087545 AGGGTCACTTCTTCTGTTTCAGG - Intergenic
1058525219 9:105850549-105850571 AGGCTCACTCCATGCCTCTGAGG - Intergenic
1060018011 9:120104152-120104174 GGTGTCTCTCCGTCTCTCTGGGG - Intergenic
1203745590 Un_GL000218v1:39249-39271 CGGGTCACTCATTCCCACTGAGG - Intergenic
1186224788 X:7387043-7387065 AGTTTCTCTCCTTCTCTTTGAGG + Intergenic
1187033785 X:15516106-15516128 GGGGTTACCCCTTATCTCTGAGG - Exonic
1187697600 X:21937578-21937600 AGAGTCATTCCTTATCTATGGGG + Intergenic
1189225859 X:39412663-39412685 AAGGGCATTCCTACTCTCTGGGG + Intergenic
1192622562 X:72693757-72693779 AGGGACACTGTATCTCTCTGAGG - Intronic
1192893651 X:75417160-75417182 ATGGACACTCCTTCCCTATGAGG - Exonic
1193912129 X:87318159-87318181 TGGGTGACTCCTTCTCACTAGGG + Intergenic
1195078310 X:101348352-101348374 AGGGTGACTCCGCTTCTCTGGGG - Intronic
1197971814 X:132122283-132122305 TGGGTCACTTCAGCTCTCTGAGG - Intronic
1198126319 X:133647631-133647653 ACAGTCACTGCTTCCCTCTGGGG + Intronic