ID: 1047215239

View in Genome Browser
Species Human (GRCh38)
Location 8:122870765-122870787
Sequence GAGGGTCACTCCTTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215239_1047215246 11 Left 1047215239 8:122870765-122870787 CCCAGAGAGAAGGAGTGACCCTC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1047215246 8:122870799-122870821 GTCACAGCAGAAATGGAGTGGGG No data
1047215239_1047215243 4 Left 1047215239 8:122870765-122870787 CCCAGAGAGAAGGAGTGACCCTC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1047215243 8:122870792-122870814 CTGAGCAGTCACAGCAGAAATGG No data
1047215239_1047215244 9 Left 1047215239 8:122870765-122870787 CCCAGAGAGAAGGAGTGACCCTC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215239_1047215245 10 Left 1047215239 8:122870765-122870787 CCCAGAGAGAAGGAGTGACCCTC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1047215245 8:122870798-122870820 AGTCACAGCAGAAATGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215239 Original CRISPR GAGGGTCACTCCTTCTCTCT GGG (reversed) Intronic
900252020 1:1675821-1675843 CAGGGTGCCTCCTTGTCTCTGGG - Intronic
900262431 1:1738679-1738701 CAGGGTGCCTCCTTGTCTCTGGG - Intronic
901823753 1:11847272-11847294 GAGGGCACCTCCATCTCTCTGGG + Exonic
903653874 1:24937110-24937132 GGGGGTCACTCCCTCTCCCCAGG - Intronic
904879662 1:33686057-33686079 GAAGGTCATTCATTCTTTCTGGG + Intronic
905194667 1:36266387-36266409 GAGGGGCACTGCTTATCTCAAGG - Intronic
905873435 1:41417746-41417768 GACAGTCACTCCCCCTCTCTGGG - Intergenic
906479228 1:46189340-46189362 GAGGGTGGCTTCTTCACTCTGGG + Exonic
906696710 1:47828168-47828190 GATGTTTCCTCCTTCTCTCTAGG + Intronic
909907036 1:81209576-81209598 AAGGCTCCTTCCTTCTCTCTTGG - Intergenic
911890927 1:103371144-103371166 GAGGGTCCCTCCCTATGTCTTGG + Intergenic
912435656 1:109659344-109659366 GAGGGTCAGTCCTTTGTTCTGGG + Intronic
912437550 1:109672449-109672471 GAGGGTCAGTCCTTTGCTCAGGG + Intronic
912440036 1:109690799-109690821 GAGGGTCAGTCCTTTGCTCAGGG + Intronic
912443393 1:109715475-109715497 GAGGGTCAGTCCTTTGCTCAGGG + Intronic
913076235 1:115342685-115342707 GAGGGTCAATCTTTCTCCCAAGG - Intergenic
913498704 1:119451165-119451187 GAGGGCCACTCAACCTCTCTGGG + Intergenic
914895246 1:151665276-151665298 AAGAATCACTCATTCTCTCTAGG - Intronic
915730550 1:158050754-158050776 GAGATTCACTTCATCTCTCTGGG + Intronic
916292080 1:163177961-163177983 GTCTTTCACTCCTTCTCTCTGGG - Intronic
916795642 1:168164853-168164875 GAGGCTCACAACTTCTCTCTGGG - Intergenic
916832938 1:168511745-168511767 CAGGGTAACTTCATCTCTCTGGG - Intergenic
917383970 1:174448178-174448200 GAGCGTCACTCCTGCCCACTTGG + Exonic
917481996 1:175420066-175420088 GAAGGGCACTGCTTCTCTCAAGG + Intronic
918570354 1:185983724-185983746 GAGGTTAAGTCCTTCTCCCTTGG + Intronic
920383580 1:205550472-205550494 GAGGCTCCTTCCTTCTCTGTTGG - Intergenic
922894288 1:229088437-229088459 GAGGGTCACCCCAATTCTCTTGG + Intergenic
924058652 1:240148151-240148173 GTGTGTCTCTCCGTCTCTCTTGG - Intronic
1069582549 10:69575507-69575529 GAGAGTCACTCCCCCTCTCTGGG - Intergenic
1070597855 10:77845233-77845255 GTGAGTCACTCCACCTCTCTGGG + Intronic
1071023085 10:81082294-81082316 GAGGGTCTTTCCCTTTCTCTTGG + Intergenic
1071906538 10:90180455-90180477 GAAGGTCACCCTTCCTCTCTGGG + Intergenic
1074885520 10:117690052-117690074 GGGGGTCACGTTTTCTCTCTGGG - Intergenic
1075158449 10:120001458-120001480 GAGGATCACCTCATCTCTCTGGG - Intergenic
1075567287 10:123513928-123513950 GAAGGTCACCGCTCCTCTCTGGG + Intergenic
1075731340 10:124638569-124638591 GTGGGTCACTCCCTCTGTCGTGG - Intronic
1076874903 10:133211150-133211172 GAGGGGCTCTGCCTCTCTCTGGG + Intronic
1077497126 11:2891799-2891821 GCCGGTCACTCCACCTCTCTGGG - Intronic
1079154602 11:17933509-17933531 GAAAGTCACTCCATCTATCTGGG + Intronic
1080397568 11:31903900-31903922 CAGGGTCACTCCTGCCCTCGTGG - Intronic
1080967695 11:37232752-37232774 GAAGGACACTCCTCTTCTCTAGG + Intergenic
1081456248 11:43225919-43225941 GAGAATCACTCTTTATCTCTTGG - Intergenic
1081673503 11:44954990-44955012 GATGGCGGCTCCTTCTCTCTGGG - Intergenic
1081872055 11:46387713-46387735 CAGGGACTCTCCTCCTCTCTGGG - Intergenic
1081937127 11:46912792-46912814 GAGGGACCCTCCCTCTGTCTGGG - Intronic
1083278804 11:61612800-61612822 TAGGGTGACTCCATCGCTCTAGG - Intergenic
1083284774 11:61651328-61651350 GAGGGACGGGCCTTCTCTCTGGG - Intergenic
1083579850 11:63818069-63818091 GAGGGCCACCCCTTCACTCCAGG - Exonic
1084259533 11:67966672-67966694 CAGGGTGACTCTTTGTCTCTTGG + Intergenic
1084572971 11:69970574-69970596 GAAGGTCACTCCCCTTCTCTGGG + Intergenic
1084942497 11:72620445-72620467 GAGGGTCCCTGCTACTCTCTGGG - Intronic
1084972761 11:72780764-72780786 GTGAGTCACTCCTGCTCTCCAGG + Intronic
1087990290 11:104740690-104740712 GGAGGTCTCTGCTTCTCTCTAGG - Intergenic
1088823733 11:113476642-113476664 CAAGGACACTCCATCTCTCTGGG - Intergenic
1089681577 11:120121771-120121793 GCGGGTCTCTCCTGCTCTGTAGG - Intronic
1089706017 11:120278403-120278425 CAAGGTCACTCGTTCTCACTGGG - Intronic
1090397170 11:126426706-126426728 TAGGTTCCCTCCTACTCTCTGGG + Intronic
1092248176 12:6875297-6875319 GAGGTTCACACCTTCACACTGGG + Intronic
1094144780 12:27216686-27216708 GAGTGTCTCACCTTCTCACTGGG + Intergenic
1094365131 12:29672128-29672150 GATGGTGACTCCATCTCCCTTGG + Intronic
1094543025 12:31378343-31378365 GAGGGTACAACCTTCTCTCTGGG - Intergenic
1096466687 12:51850563-51850585 GTGTGTCACTTCTCCTCTCTGGG - Intergenic
1099244585 12:80179914-80179936 GGAGGTCACTCCTCCTCTCACGG - Intergenic
1101850945 12:108401818-108401840 GAGTGTCACTCCTCCTCCCAGGG - Intergenic
1104950176 12:132436458-132436480 CAGGGTCTCTCCTTCTCCTTCGG - Intergenic
1104950187 12:132436508-132436530 CAGGGTCTCTCCTTCTCCTTCGG - Intergenic
1104950268 12:132436856-132436878 CAGGGTCTCTCCTTCTCCTTCGG - Intergenic
1105599356 13:21872111-21872133 AAGTGTGACTCCTTCTCTCCAGG + Intergenic
1105830120 13:24156850-24156872 CAGGTTCTCTCCTGCTCTCTTGG + Intronic
1108076588 13:46686381-46686403 GAGGATCATTCCTTCCTTCTGGG + Intronic
1108367642 13:49731812-49731834 GAGTTTTACTCCTTCTCTCCTGG + Intronic
1111928244 13:94485642-94485664 GCAGGTCACTCTTTCTCTCACGG + Intergenic
1114189539 14:20430054-20430076 CAGGCTCCCTCCGTCTCTCTTGG + Exonic
1115233974 14:31190597-31190619 GAGAGTCAGTCCTACTCTGTAGG + Intronic
1116113107 14:40612273-40612295 GAAGGTCACTGATTCTCTCAGGG - Intergenic
1116389997 14:44380376-44380398 GTGGGTAATTCCTTTTCTCTAGG - Intergenic
1118253693 14:64186298-64186320 GAAGGTCCCTCCCTCTCTCCTGG + Intronic
1118663642 14:68042636-68042658 GAGGGACGCTCCTTTTCTCAAGG - Intronic
1119087983 14:71754431-71754453 GAGGCTCTCTTCTTCCCTCTCGG + Intergenic
1119411238 14:74432051-74432073 GAGTGTTTCCCCTTCTCTCTGGG - Intergenic
1121523221 14:94600330-94600352 GAGGGTGTCTCCTTATCTCTGGG + Intronic
1122059547 14:99127552-99127574 TAGGGTCTCTCTTTCTCTCTGGG - Intergenic
1122299930 14:100725725-100725747 GAGGAGCACTCCCTCTCCCTGGG + Intronic
1122632969 14:103116027-103116049 GTGAGTCACTCCACCTCTCTGGG + Intergenic
1123028743 14:105440712-105440734 GAGGGGCACGACTACTCTCTTGG + Intronic
1128717495 15:69919379-69919401 GAAACTCACTCCTCCTCTCTGGG + Intergenic
1128862885 15:71089500-71089522 GAGGGTCTCCTTTTCTCTCTGGG + Intergenic
1129720012 15:77872783-77872805 GAGGTTCCTCCCTTCTCTCTAGG - Intergenic
1130601946 15:85281671-85281693 CAAGCTCACTCCTTCTCACTGGG + Intergenic
1134231910 16:12436221-12436243 GAGGGCCACGCCTCCTCCCTGGG + Intronic
1134627028 16:15729507-15729529 GAGGGTCAGTGATTCTGTCTGGG + Intronic
1135409687 16:22224227-22224249 TAGGGCCACTCCTTCATTCTGGG + Intronic
1137380868 16:47998486-47998508 GAGGATCCCACCTTCTGTCTTGG + Intergenic
1140919180 16:79520919-79520941 GATGGTAACTCCTTCTTTCTAGG - Intergenic
1141893400 16:86943000-86943022 GAGGGTCTGTCCTGCTCCCTGGG - Intergenic
1141918167 16:87114976-87114998 GCGGGTTGCTTCTTCTCTCTGGG - Intronic
1142123725 16:88399957-88399979 GCGGGTCACTCCACCTCCCTGGG + Intergenic
1143739515 17:8942177-8942199 GAGGGTCTGCCCTTCCCTCTAGG - Intronic
1144682425 17:17204771-17204793 GAGGATGTCTCCTTCTCTTTGGG - Intronic
1144855134 17:18263333-18263355 GCGAGTCCCTGCTTCTCTCTCGG + Intronic
1145328377 17:21850461-21850483 AAGAGTCACTCCACCTCTCTGGG - Intergenic
1145415301 17:22709751-22709773 AAGAGTCACTCCACCTCTCTGGG - Intergenic
1145695160 17:26781805-26781827 AAGAGTCACTCCACCTCTCTGGG - Intergenic
1145906445 17:28518837-28518859 GCAGGTCATTTCTTCTCTCTGGG + Intronic
1147445833 17:40474814-40474836 GAGAGCGCCTCCTTCTCTCTGGG - Intergenic
1148153443 17:45409892-45409914 GAAGGCCACTTCTTGTCTCTAGG - Intronic
1148794670 17:50191294-50191316 CAGCATCTCTCCTTCTCTCTGGG - Intronic
1148995125 17:51702777-51702799 GAGGGTCCCTGGTTCTCTCAGGG + Intronic
1150785773 17:68161784-68161806 TGGGGTAACTCCTTCTCTCATGG + Intergenic
1151056407 17:71036997-71037019 AGGAGTCATTCCTTCTCTCTGGG - Intergenic
1152771718 17:82173862-82173884 GAAGGACACTCCCTCTCCCTAGG - Intronic
1153504087 18:5778166-5778188 GAAGGTCACTTAATCTCTCTGGG - Intergenic
1153759321 18:8315103-8315125 CACGGTCACTCCTTTTCTCAAGG + Intronic
1153803048 18:8688317-8688339 TAGGGTCACTCCGTCTCTTGTGG + Intergenic
1156304555 18:35865071-35865093 GAGAGTTACTCCGTCTCTCTAGG - Intergenic
1158984681 18:62801908-62801930 GAGCATCACTCCTAGTCTCTAGG + Intronic
1159659767 18:71079559-71079581 GAGGGTATCTGCCTCTCTCTCGG - Intergenic
1160329235 18:77977228-77977250 CAGGGCCACCCCTTCTCTCTGGG - Intergenic
1160688116 19:446737-446759 CTGGGTCATGCCTTCTCTCTGGG - Intronic
1161156325 19:2733502-2733524 GTGGGTCTCTCTCTCTCTCTCGG - Intronic
1161260672 19:3336092-3336114 GCAGGTCACTCCTTTTCTCTGGG + Intergenic
1161742023 19:6027239-6027261 GAGGGTAACTGCTTCTCCCACGG + Intronic
1161895028 19:7073843-7073865 CAGGGCCACTCAGTCTCTCTAGG - Intronic
1162828491 19:13269314-13269336 GCAGGTCACTCTTTTTCTCTAGG - Intronic
1163237996 19:16040442-16040464 CAGGCTCACTCCTTCTCCCATGG - Intergenic
1163887970 19:19984962-19984984 GATGGTCTCCCCTTTTCTCTTGG - Intergenic
1164668400 19:30058610-30058632 GAGAGCCTCTCCTTTTCTCTGGG + Intergenic
1165016754 19:32886697-32886719 GAGGATCACTCCTTCTCTTTTGG + Intronic
1165987933 19:39786944-39786966 GTGGTTCACTGCTTCTCTCCTGG - Intergenic
926270918 2:11365362-11365384 GAGGGTCTCCCCTTTTCTCTTGG - Intergenic
926681474 2:15667059-15667081 GAGTGCCTCTCCTTCTCTCTGGG - Intergenic
931571780 2:63676347-63676369 CAGGGTCACTCCTCCTTTGTGGG - Intronic
931643291 2:64399960-64399982 AAGGGTCAGTCCTTGTCTCCTGG - Intergenic
931960741 2:67479605-67479627 GAGGGTCCTTCCTCCTGTCTGGG - Intergenic
932310613 2:70736844-70736866 GATGCTCCCTCCTTCTCTCCTGG - Intronic
932466849 2:71929545-71929567 GCTGGTCACTTCTCCTCTCTGGG + Intergenic
932939366 2:76144263-76144285 GAAGGTCACTCCAGCTCTCCAGG - Intergenic
934652009 2:96098180-96098202 GTGAGTCCCTCCTCCTCTCTGGG - Intergenic
935364927 2:102279196-102279218 GAGCGGCATTCCTACTCTCTGGG - Intergenic
935697324 2:105781435-105781457 GAGGGTCACTAGTTCTGGCTGGG - Intronic
938115651 2:128601618-128601640 TAGGGTCACACCTGCTGTCTCGG - Intergenic
938119922 2:128626127-128626149 GAGGGTCACTGCTGACCTCTTGG - Intergenic
939317084 2:140565992-140566014 CAGTGTCACTCCTTCTCTGGGGG - Intronic
939440449 2:142242474-142242496 GAGGGTCACTCCTAATCACTGGG - Intergenic
943746498 2:191467682-191467704 GTTGGTCAGTCCTACTCTCTTGG - Intergenic
945572932 2:211493050-211493072 AAGAGTGACTCCATCTCTCTGGG - Intronic
945977548 2:216282485-216282507 CAGTCTCACTCCTCCTCTCTGGG - Intronic
947533123 2:230925246-230925268 GAGAGTCACTTCCCCTCTCTGGG + Intronic
948826692 2:240576513-240576535 CAGGGTCACTTCTCCCCTCTAGG + Exonic
1169826283 20:9772234-9772256 GAGGGTCACCACTAATCTCTTGG - Intronic
1171518617 20:25759107-25759129 AAGAGTCACTCCACCTCTCTGGG - Intergenic
1172189974 20:33056070-33056092 GATGGTCTCTGCTTCTCTCCTGG - Intronic
1173920271 20:46739449-46739471 GAAGGTCAATGCTTCTTTCTAGG - Intergenic
1174145368 20:48449549-48449571 GGAGCTCACTCCTCCTCTCTGGG + Intergenic
1174450521 20:50617223-50617245 GAAGGTCACTCACACTCTCTGGG + Intronic
1175335229 20:58191562-58191584 GAGACTTTCTCCTTCTCTCTGGG + Intergenic
1175740564 20:61417204-61417226 GAGACTCACTCTTTCTCTCTTGG + Intronic
1175760939 20:61561963-61561985 GAAGGTCCCTCTCTCTCTCTGGG - Intronic
1175761014 20:61562199-61562221 GAAGGTCCCTCTCTCTCTCTGGG - Intronic
1176238840 20:64066674-64066696 GAGGGTCTCTGCCTTTCTCTGGG + Intronic
1176652759 21:9565510-9565532 AAGTGTCACTCCACCTCTCTGGG - Intergenic
1181544798 22:23596033-23596055 CAGGGGCACTTCTGCTCTCTAGG + Intergenic
1181815510 22:25433826-25433848 CAGGGGCACTCCTGCTCTGTAGG - Intergenic
1182102705 22:27669377-27669399 GTGGGTCACTTCCCCTCTCTGGG + Intergenic
1183074040 22:35415503-35415525 GAGGCTAACTCCTCTTCTCTGGG + Intronic
1183343701 22:37295610-37295632 GCGAGTCACTTCCTCTCTCTGGG - Intronic
1183505807 22:38208279-38208301 GTGAGCCACTCCATCTCTCTGGG - Intronic
1183545003 22:38450711-38450733 GCAGGTCATTCCTTGTCTCTGGG + Intronic
1184749102 22:46474018-46474040 GAGGCTCACTCTTCCTCTCGTGG - Intronic
949424249 3:3899365-3899387 GTGGCTTCCTCCTTCTCTCTTGG + Intronic
949944416 3:9178753-9178775 GAGGGGCACAGCTTCTCCCTAGG - Intronic
952944857 3:38472526-38472548 GAGTGGCACTCCTTCTCACCTGG + Intronic
954717965 3:52536288-52536310 GAGGGTCATCACTTCTATCTGGG + Intronic
955597594 3:60608482-60608504 GAGGTTCAGTCCAGCTCTCTGGG + Intronic
955846182 3:63165159-63165181 AAGGGTCAGTCTTTCTGTCTTGG - Intergenic
958803890 3:98786388-98786410 GTTGGTCACTCCTTCTGTCCTGG - Intronic
961369218 3:126419321-126419343 GAGAGTCACTGAATCTCTCTTGG - Intronic
961749417 3:129086607-129086629 GCAGGTCACTTCTCCTCTCTGGG - Intergenic
962388125 3:134949333-134949355 CATGGTCACTCCTTCTGTCTGGG - Intronic
964087736 3:152836837-152836859 GAGGGTCATGTCTTCACTCTTGG - Exonic
964423088 3:156525130-156525152 GAGTGTTACTCCTTCTTACTAGG + Intronic
964626490 3:158764766-158764788 GAGAGTCCCTCCTCCTCTCCAGG + Intronic
965737879 3:171840978-171841000 AAGTGTCACTGCTTCTGTCTTGG - Intergenic
966673669 3:182560855-182560877 GAAGGTTACTCCTTAGCTCTAGG - Intergenic
967121631 3:186387445-186387467 GAGGGCCTCTCCTTGTATCTAGG - Intergenic
967316375 3:188154645-188154667 GGGCGACCCTCCTTCTCTCTGGG - Intronic
969143720 4:5102076-5102098 CTGGTTCACTCCTTATCTCTGGG - Intronic
969846678 4:9925077-9925099 GAGGCTCCCCCCATCTCTCTTGG + Intronic
970861272 4:20705485-20705507 GTCGGACACTCCTTCTGTCTTGG - Intronic
973833432 4:54785056-54785078 GTGAGTCATTCATTCTCTCTGGG + Intergenic
976443203 4:85100654-85100676 GAAGACCAGTCCTTCTCTCTCGG - Intergenic
978308780 4:107362970-107362992 GAAGGAAACTCCTTCTCTCAAGG + Intergenic
978505237 4:109449684-109449706 TAAGGGCACTCCTTCTCTCATGG + Intronic
984107125 4:175561917-175561939 CAAGGTCTCTCCTTTTCTCTGGG + Intergenic
984788965 4:183596302-183596324 GAGGGTCATTCCTTCTAACAGGG + Intergenic
985103438 4:186479868-186479890 CAAGGACACTCCTTCCCTCTGGG + Intronic
985535953 5:465896-465918 GCAGGTCCCTCCTTCTGTCTGGG + Intronic
986428993 5:7663363-7663385 GAGAGTCACCCCATGTCTCTGGG + Intronic
988704563 5:33711795-33711817 TAGGGTCACTCCTTCTCTCCAGG - Intronic
991632012 5:68665687-68665709 GAAGGTCACTGCTGCTCTCAAGG + Intergenic
995632969 5:114153910-114153932 GAAGGTCACTGTTTCTCTCAAGG + Intergenic
997539340 5:134648796-134648818 GGGCCTCCCTCCTTCTCTCTAGG + Exonic
998254638 5:140575322-140575344 GAGGGTCAGACGCTCTCTCTGGG + Intronic
999547237 5:152643127-152643149 GAGTGCAACTCCTTTTCTCTGGG - Intergenic
999953949 5:156680200-156680222 GCAGGTCACTCCACCTCTCTAGG - Intronic
1000729054 5:164808619-164808641 GAGTCTCACTCTTTCTCCCTGGG + Intergenic
1001336521 5:170801927-170801949 GAGTCCCACTCCTTGTCTCTTGG - Intronic
1005851978 6:29828986-29829008 GAGGGTCCGTCCTGCTCTCTGGG + Intronic
1006742524 6:36319697-36319719 GCGGGGCACTCCTTGTCCCTGGG + Intronic
1006971222 6:38047747-38047769 AAGGGCCACTCCTTCATTCTGGG + Intronic
1007245132 6:40456034-40456056 GCGGGTCTCTCCTTCTTCCTAGG - Intronic
1008496236 6:52137078-52137100 GCGGGTCCCTCCTCCTCGCTGGG - Intergenic
1008869812 6:56260025-56260047 GTGGGTCACACCTACCCTCTGGG - Intronic
1010509863 6:76704996-76705018 GAGCGTCATTTCTTCCCTCTGGG - Intergenic
1011129934 6:84042376-84042398 GAGGGTTAATCCTTATTTCTAGG + Intronic
1012033529 6:94102591-94102613 GAAGGGCACGCCTTCACTCTGGG - Intergenic
1015325977 6:131923956-131923978 GAAGGTCATTGCCTCTCTCTGGG - Intergenic
1015371324 6:132456880-132456902 GATGGTCTCTCCTTTTCTCATGG - Exonic
1015845092 6:137511903-137511925 GTGAGTCACTCATTTTCTCTTGG - Intergenic
1019028030 6:168988245-168988267 GAGAGTGACCCCTTCACTCTGGG + Intergenic
1019153817 6:170025827-170025849 GTGGGTCTCCCCTTCTCACTGGG + Intergenic
1019575162 7:1734251-1734273 GAGGGTCATTCCTCCTCTCCCGG + Intronic
1020998965 7:15303515-15303537 GGGGGTCATTTCTTCTCACTGGG - Intronic
1021166338 7:17347182-17347204 GAGAGGCTCTCCTTCTCTGTAGG + Intergenic
1023158511 7:37275345-37275367 AAGGTTCACTCCTTCTTTTTTGG + Intronic
1026101628 7:67388963-67388985 GCAGGTCACTTCATCTCTCTGGG + Intergenic
1026947228 7:74324537-74324559 GAGGGACACTTTCTCTCTCTGGG - Intronic
1027237137 7:76304750-76304772 GGGTCTCACTCTTTCTCTCTGGG - Intergenic
1029064997 7:97840540-97840562 TAAGGACACTCCTTTTCTCTGGG - Intergenic
1032793322 7:135258375-135258397 GAGGGTCACTTTTTATCTGTGGG - Intronic
1032851429 7:135798909-135798931 GAGGGGCATTCCGCCTCTCTAGG + Intergenic
1034344375 7:150377306-150377328 GGGGGTCACTTCCACTCTCTGGG - Intronic
1034555797 7:151849662-151849684 GAGGGTCACTGGCTCTCCCTGGG + Intronic
1037659182 8:20912480-20912502 GAAGGTCACTAGTTCTTTCTGGG + Intergenic
1040304078 8:46203038-46203060 CAGGGTGACTCTGTCTCTCTTGG + Intergenic
1041413008 8:57577326-57577348 AAGGGCCACTGCTGCTCTCTAGG - Intergenic
1042615166 8:70640537-70640559 GCAGGTCACCCCTCCTCTCTTGG + Intronic
1047215239 8:122870765-122870787 GAGGGTCACTCCTTCTCTCTGGG - Intronic
1047997921 8:130354534-130354556 GAGGGTCCCTTCTACTGTCTGGG + Intronic
1048919562 8:139215520-139215542 GTGAGTCACTTCCTCTCTCTGGG - Intergenic
1049231979 8:141489207-141489229 GAGGGACACTCCTTCTGCCAAGG - Intergenic
1049658152 8:143807953-143807975 AAGGGTCTCACCTGCTCTCTGGG - Intronic
1049811832 8:144578817-144578839 CAGGGTCTCTCTTTGTCTCTGGG - Intronic
1051618511 9:19029357-19029379 GTGAGTCACTGGTTCTCTCTGGG - Intronic
1052635164 9:31093755-31093777 GAGAGTCCCTACTTTTCTCTAGG - Intergenic
1056387227 9:86107098-86107120 GAGGGCCAGTCCTGCTTTCTTGG + Intergenic
1058380033 9:104367647-104367669 GAGGGTAAATGCTTCTCTTTTGG - Intergenic
1058459806 9:105172419-105172441 GAAGGTCAGGCCTTCTCTCAAGG - Intergenic
1059349599 9:113655087-113655109 GAGAGTCACTTTTTGTCTCTGGG + Intergenic
1059442348 9:114315522-114315544 GTAGGTCATTCTTTCTCTCTAGG + Intergenic
1060193870 9:121610450-121610472 GCAAGTCACTCCTCCTCTCTGGG - Intronic
1060267200 9:122119078-122119100 GACAGTCACTCCCTCTGTCTGGG + Intergenic
1060727456 9:126015906-126015928 GAGGTTCATTCCTTGTCTATAGG + Intergenic
1061006154 9:127929448-127929470 GTGGGTCTCTGCCTCTCTCTGGG - Intronic
1061201952 9:129143145-129143167 GAGGGTGTCTCCTGCCCTCTTGG + Intronic
1062167048 9:135113126-135113148 GAGAGGCCTTCCTTCTCTCTGGG + Intronic
1203630490 Un_KI270750v1:69051-69073 AAGAGTCACTCCACCTCTCTGGG - Intergenic
1186933437 X:14420214-14420236 GAGGGGTAATCCTTCTCTCTTGG - Intergenic
1187697599 X:21937577-21937599 GAGAGTCATTCCTTATCTATGGG + Intergenic
1189225858 X:39412662-39412684 GAAGGGCATTCCTACTCTCTGGG + Intergenic
1189422919 X:40872924-40872946 GAAGGTCATTCTTTCTCTCTAGG - Intergenic
1189524534 X:41805854-41805876 TAGGGGCACTCCGTCTCTCAGGG - Intronic
1190558582 X:51664338-51664360 GACGGTCACTCTTTTTCTATTGG + Intergenic
1193912128 X:87318158-87318180 ATGGGTGACTCCTTCTCACTAGG + Intergenic
1193995784 X:88364888-88364910 GAGGATCACCCCTTCTCTTAGGG + Intergenic
1194796004 X:98211402-98211424 GAGGGAGACTCCATCTGTCTGGG + Intergenic
1195094033 X:101489128-101489150 CTGGGTCATTGCTTCTCTCTTGG - Exonic
1195944839 X:110198744-110198766 GGCAGTCACTGCTTCTCTCTGGG - Intronic
1195974506 X:110511590-110511612 AAAGGTCACTGCTTCTCTCAAGG + Intergenic
1197803050 X:130372219-130372241 GAGGGTATCTCGTTCCCTCTTGG + Intronic
1200903954 Y:8462115-8462137 GTGAGTCTCTACTTCTCTCTGGG + Intergenic
1201578540 Y:15487038-15487060 AAGGAACACTCATTCTCTCTTGG - Intergenic