ID: 1047215240

View in Genome Browser
Species Human (GRCh38)
Location 8:122870766-122870788
Sequence AGAGGGTCACTCCTTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 424}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215240_1047215245 9 Left 1047215240 8:122870766-122870788 CCAGAGAGAAGGAGTGACCCTCT 0: 1
1: 0
2: 2
3: 30
4: 424
Right 1047215245 8:122870798-122870820 AGTCACAGCAGAAATGGAGTGGG No data
1047215240_1047215243 3 Left 1047215240 8:122870766-122870788 CCAGAGAGAAGGAGTGACCCTCT 0: 1
1: 0
2: 2
3: 30
4: 424
Right 1047215243 8:122870792-122870814 CTGAGCAGTCACAGCAGAAATGG No data
1047215240_1047215246 10 Left 1047215240 8:122870766-122870788 CCAGAGAGAAGGAGTGACCCTCT 0: 1
1: 0
2: 2
3: 30
4: 424
Right 1047215246 8:122870799-122870821 GTCACAGCAGAAATGGAGTGGGG No data
1047215240_1047215244 8 Left 1047215240 8:122870766-122870788 CCAGAGAGAAGGAGTGACCCTCT 0: 1
1: 0
2: 2
3: 30
4: 424
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215240 Original CRISPR AGAGGGTCACTCCTTCTCTC TGG (reversed) Intronic
900252021 1:1675822-1675844 ACAGGGTGCCTCCTTGTCTCTGG - Intronic
900262432 1:1738680-1738702 ACAGGGTGCCTCCTTGTCTCTGG - Intronic
900538148 1:3189068-3189090 TGCGGGTGACTCCTTCTCTGAGG + Intronic
900667964 1:3828328-3828350 AGAGGCTCACTCCTCATCCCAGG + Intronic
900680427 1:3913321-3913343 AGAGGGTCACCCCATCTCTCTGG + Intergenic
901266582 1:7915097-7915119 AGAGTCTCACTCTGTCTCTCGGG + Intergenic
901730960 1:11279447-11279469 AGAGTCTCACTCCGTCTCCCAGG + Intronic
901931453 1:12598347-12598369 AGAGTCTCACTCCATCACTCAGG - Intronic
902991386 1:20189700-20189722 AGAGTCTCACTCCATCACTCAGG - Intronic
904462146 1:30686479-30686501 AGAGGGTCCCTCCTGCTGACAGG - Intergenic
906006791 1:42479971-42479993 AGATGGGGACTCTTTCTCTCTGG + Intronic
906416806 1:45626360-45626382 AGAGTCTCACTCTTTCTCCCAGG + Intergenic
906441893 1:45854309-45854331 AGAGGGTCACTCTGTCACCCAGG - Intronic
906525999 1:46493619-46493641 ATGGGGTCACTCCTTCCCTCTGG + Intergenic
907015570 1:51009323-51009345 AGAGTCTCACTCTATCTCTCAGG - Intergenic
907895027 1:58679999-58680021 AGAGTCTCACTCTTTCTCCCAGG - Intronic
908376147 1:63543993-63544015 AGAGGCTCACTCTGTCTCCCAGG + Intronic
909550402 1:76893684-76893706 AGAGGCTCACTCCGTCACCCAGG + Intronic
911499225 1:98664502-98664524 AGAGTCTCACTCCGTCACTCAGG - Intronic
911625750 1:100122576-100122598 AGAGGCTCACTCCATCACCCAGG + Intronic
911716751 1:101142040-101142062 AGAGGCTCACTCCATCACCCAGG - Intergenic
911911009 1:103635042-103635064 AGAGTGTCACTCTATCTCCCAGG - Intergenic
911918424 1:103729167-103729189 AGAGTGTCACTCTATCTCCCAGG - Intronic
912079588 1:105918545-105918567 CGAAGGTCACTCCTGCTCTCAGG + Intergenic
912221257 1:107679166-107679188 AGATGGTCACTTCCTCTTTCAGG - Intronic
912435655 1:109659343-109659365 AGAGGGTCAGTCCTTTGTTCTGG + Intronic
912437549 1:109672448-109672470 AGAGGGTCAGTCCTTTGCTCAGG + Intronic
912440035 1:109690798-109690820 AGAGGGTCAGTCCTTTGCTCAGG + Intronic
912443392 1:109715474-109715496 AGAGGGTCAGTCCTTTGCTCAGG + Intronic
912822408 1:112878649-112878671 AGAGGGTGGCACCATCTCTCAGG + Intergenic
915421716 1:155787916-155787938 AGAGTCTCACTCTGTCTCTCAGG - Intronic
915758347 1:158285828-158285850 AGTGATTCACTCCTTCTTTCTGG - Intergenic
916292081 1:163177962-163177984 AGTCTTTCACTCCTTCTCTCTGG - Intronic
916568731 1:166006807-166006829 AGAGTTTCACTCTTTCGCTCAGG + Intergenic
916795643 1:168164854-168164876 AGAGGCTCACAACTTCTCTCTGG - Intergenic
916832939 1:168511746-168511768 ACAGGGTAACTTCATCTCTCTGG - Intergenic
918940547 1:190990824-190990846 AGAGTTTCACTCTGTCTCTCAGG + Intergenic
920852163 1:209635426-209635448 AGAGCCTCACTCCGTCACTCAGG + Intronic
921045911 1:211478069-211478091 AGCTGGTCACACCTGCTCTCTGG - Exonic
921138123 1:212281149-212281171 AAAGTGTCACTCTTTCTCCCAGG + Intergenic
922134993 1:222815484-222815506 AGGGAGTCAGTCCTTCTCTGAGG + Intergenic
922248286 1:223821915-223821937 AGAGTCTCACTCCATCTCCCAGG + Intronic
922286324 1:224173918-224173940 AGAGTCTCACTCCTTCACCCAGG + Intergenic
922298582 1:224274263-224274285 AGAGTCTCACTCTTTCTCCCAGG - Intronic
922549991 1:226487679-226487701 AGAGTCTCACTCCGTCACTCAGG - Intergenic
1063254242 10:4308678-4308700 AGAGTCTCACTCCATCTCCCAGG - Intergenic
1063681743 10:8194799-8194821 AGAGTCTCACTCTGTCTCTCAGG - Intergenic
1064329848 10:14383355-14383377 AAAGGGTCACTCCATCTCCAGGG - Intronic
1064531219 10:16312289-16312311 AGAGTGTCACTCCATCACCCAGG + Intergenic
1064543692 10:16430188-16430210 AGAGAGTCACTCTGTCACTCAGG - Intergenic
1065289647 10:24216799-24216821 AGAGTCTCACTCCATCACTCAGG - Intronic
1065441250 10:25755737-25755759 AGAGTGTCACTCTGTCACTCAGG - Intergenic
1065749495 10:28872653-28872675 AGGGGCTCACTCCATCACTCAGG - Intronic
1065890404 10:30116508-30116530 AGTGGGCCTGTCCTTCTCTCTGG + Intergenic
1068333284 10:55600336-55600358 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1069249849 10:66254806-66254828 AGACAGACACTCCTTCTCTAGGG - Intronic
1069582550 10:69575508-69575530 AGAGAGTCACTCCCCCTCTCTGG - Intergenic
1070467062 10:76733999-76734021 AGAGGGACTCTCTTTCTCTATGG - Intergenic
1070924526 10:80210048-80210070 AAAGGGTCAATGCTTCTCACAGG + Intergenic
1070958422 10:80481077-80481099 AGAGTCTCACTCCTTCACCCTGG - Intronic
1071286510 10:84152771-84152793 TGCAGGTGACTCCTTCTCTCTGG - Exonic
1071387249 10:85133821-85133843 AGAGACTCCCTCCTCCTCTCAGG - Intergenic
1071559931 10:86637817-86637839 ACAGGGTGAGTCCTTGTCTCAGG - Intergenic
1073014244 10:100385419-100385441 AGAGTCTCACTCCGTCTCCCAGG + Intergenic
1073178119 10:101568935-101568957 AGTGGACCACTCCTCCTCTCAGG - Intergenic
1074115942 10:110457648-110457670 AGAGGGAAAATCCTTCTCTTAGG - Intergenic
1075161291 10:120026903-120026925 AGAGGCTCACTCTGTCACTCAGG - Intergenic
1076520165 10:131076324-131076346 TGAGGGTCACTCCAATTCTCCGG + Intergenic
1078809727 11:14746357-14746379 AGAGTGTCACTCCATCACCCAGG - Intronic
1081913806 11:46718426-46718448 TGAGGGGCCCTCCTTCTCCCTGG - Intergenic
1081937128 11:46912793-46912815 AGAGGGACCCTCCCTCTGTCTGG - Intronic
1082864489 11:57886313-57886335 AGAGTCTCACTCCTTCACCCAGG + Intergenic
1082907324 11:58323566-58323588 AGAGTCTCACTCTTTCACTCAGG + Intergenic
1083284775 11:61651329-61651351 AGAGGGACGGGCCTTCTCTCTGG - Intergenic
1084012179 11:66358050-66358072 AGAGTCTCACTCCGTCGCTCAGG - Intronic
1084942498 11:72620446-72620468 GGAGGGTCCCTGCTACTCTCTGG - Intronic
1085580239 11:77643914-77643936 GGAGGCTCACTCTTTCTCCCAGG - Intergenic
1085681480 11:78579035-78579057 AGAGTCTCACTCCATCGCTCAGG - Intergenic
1085845437 11:80059608-80059630 AGAAGGACAGTGCTTCTCTCTGG - Intergenic
1086338076 11:85819470-85819492 AGATGGTCTCTCCTTCTCCTAGG + Intergenic
1088225600 11:107616403-107616425 AGAGTCTCACTCCTTCACCCAGG + Intronic
1088258131 11:107920268-107920290 AGAGTCTCACTCTGTCTCTCAGG + Intronic
1088627867 11:111745075-111745097 AGAGCCTCACTCTGTCTCTCAGG + Intronic
1088766353 11:112983440-112983462 AGAGGGTGAATTCTTCTCCCAGG + Intronic
1090113180 11:123938619-123938641 AGAGTCTCACTCCATCTCCCAGG + Intergenic
1090839127 11:130473968-130473990 AGAGGTTCCCTCCTCCTCCCTGG + Exonic
1092248175 12:6875296-6875318 AGAGGTTCACACCTTCACACTGG + Intronic
1092259679 12:6946226-6946248 AGGGGGTACCTCCTTCTCTGAGG + Intergenic
1092293601 12:7180766-7180788 AGAGCCTCACTCCATCTCCCAGG - Intergenic
1092496437 12:9000007-9000029 AGAGTATCACTCTGTCTCTCAGG - Intronic
1093470780 12:19499586-19499608 AGAGTCTCACTCCTTCACCCAGG - Intronic
1093562098 12:20553388-20553410 ACAGGATCAGTCCTTCTCTCGGG + Intronic
1093724799 12:22491844-22491866 AGAGTTTCACTCTTTCACTCAGG - Intronic
1094392812 12:29971173-29971195 AAAGGCTCACTGCTTCTCTCTGG + Intergenic
1094543026 12:31378344-31378366 AGAGGGTACAACCTTCTCTCTGG - Intergenic
1095262976 12:40119191-40119213 AGAGTGTCACTCTGTCACTCAGG - Intergenic
1096287951 12:50316482-50316504 AGAGTGTCACTCTGTCGCTCAGG - Intergenic
1096367328 12:51039699-51039721 AGAGTCTCACTCTGTCTCTCAGG - Intergenic
1096466688 12:51850564-51850586 AGTGTGTCACTTCTCCTCTCTGG - Intergenic
1096828240 12:54295394-54295416 AGGCGGTCTCTCCTTCCCTCAGG - Exonic
1097705349 12:62863044-62863066 AGAGGCTCACTCCATCACCCAGG + Intronic
1098124658 12:67278160-67278182 AGAGTGTCACTCTTTTGCTCAGG + Intronic
1098348047 12:69526747-69526769 AGAGTGTCACTCCGTCACCCAGG + Intronic
1098769333 12:74533818-74533840 AGAGTCTCACTCTGTCTCTCAGG - Intergenic
1100572494 12:95856458-95856480 AGAGTGTCACTCCGTCACCCAGG - Intergenic
1100848863 12:98688495-98688517 AGAGTCTCACTCTTTCACTCAGG + Intronic
1100949021 12:99824472-99824494 AGAGTCTCACTCCTTCGCCCAGG - Intronic
1101850946 12:108401819-108401841 AGAGTGTCACTCCTCCTCCCAGG - Intergenic
1102034190 12:109761567-109761589 GCAGGCTCTCTCCTTCTCTCTGG - Intronic
1102439690 12:112951984-112952006 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1102854574 12:116281986-116282008 AGAGGCTCACTCCATCGCCCAGG - Intergenic
1103198457 12:119066993-119067015 AAAGGCTCCCTGCTTCTCTCAGG + Intronic
1103268468 12:119651344-119651366 AGAGAGGCCTTCCTTCTCTCAGG - Intergenic
1103474599 12:121209526-121209548 AAAGGGTCTCTTGTTCTCTCTGG + Intergenic
1105554082 13:21428829-21428851 AGAGTGTCACTCTTTCACCCAGG - Intronic
1105893252 13:24697153-24697175 AGAGGTTCAATGCTTCACTCAGG - Intronic
1106052627 13:26205985-26206007 ACAGGGTTACTCTGTCTCTCAGG - Intronic
1106332616 13:28753435-28753457 ATAGGGTCTCTCTCTCTCTCTGG - Intergenic
1106523509 13:30519365-30519387 AGAGTGTCACTCTGTCACTCAGG - Intronic
1106599904 13:31178845-31178867 GGAGTGTCACTCTGTCTCTCAGG + Intergenic
1106899631 13:34341397-34341419 AGAGAGTAACTCATTCTCTTAGG - Intergenic
1110194899 13:72777611-72777633 AGAGTCTCACTCTGTCTCTCAGG + Intronic
1110272767 13:73609576-73609598 AGAGGCTCACTCCATCACCCAGG + Intergenic
1111413954 13:87913802-87913824 AGAGGGTCAGCCCATCCCTCTGG - Intergenic
1111815536 13:93148150-93148172 GGAGGTTCAGTCTTTCTCTCTGG - Intergenic
1111821662 13:93223467-93223489 AGAGTCTCACTCTTTCTCCCAGG + Intergenic
1114646192 14:24257635-24257657 AGGAGGTCACTCCATCTCTCTGG + Intronic
1114919929 14:27313173-27313195 AGAGTCTCACTCTGTCTCTCAGG - Intergenic
1114999949 14:28410069-28410091 AGAGTCTCACTCTTTCACTCAGG - Intergenic
1115249219 14:31328852-31328874 AGAGTCTCACTCCGTCTCCCAGG - Intronic
1115845847 14:37533244-37533266 AGACGGTCACTGCTTCTTTCTGG - Intronic
1116113108 14:40612274-40612296 TGAAGGTCACTGATTCTCTCAGG - Intergenic
1118340347 14:64890721-64890743 AGAGTCTCACTCCTTCGCCCAGG - Intergenic
1119512541 14:75222681-75222703 AGAGTGGCCTTCCTTCTCTCAGG + Intergenic
1120467123 14:84873513-84873535 TGAGTGTCACTCCGTCACTCAGG + Intergenic
1121523220 14:94600329-94600351 AGAGGGTGTCTCCTTATCTCTGG + Intronic
1122059548 14:99127553-99127575 ATAGGGTCTCTCTTTCTCTCTGG - Intergenic
1122671769 14:103378291-103378313 AGAGACTCACTCCTCCTCCCCGG - Intergenic
1124438041 15:29667211-29667233 AGAGTCTCACTCCGTCTCCCAGG + Intergenic
1125729331 15:41884009-41884031 AGAGTCTCACTCCTTCGCCCAGG + Intronic
1126651133 15:50922304-50922326 AGAGTCTCACTCCATCACTCAGG - Intronic
1126796607 15:52264907-52264929 AGAAGGTCACTGCTCCTCTGGGG + Intronic
1126960693 15:53990899-53990921 AGAGGGGGTCTCCTTCTATCAGG - Intergenic
1127343180 15:58067030-58067052 AGGGTCTCACTCCTTCACTCAGG + Intronic
1127432087 15:58920293-58920315 AGAGTGTCGCTCTGTCTCTCAGG - Intronic
1127869607 15:63060339-63060361 AGAGGCTCCCTTCCTCTCTCTGG + Intronic
1128306960 15:66605049-66605071 AGAGTCTCACTCCATCTCCCAGG - Intronic
1128717494 15:69919378-69919400 AGAAACTCACTCCTCCTCTCTGG + Intergenic
1128862884 15:71089499-71089521 AGAGGGTCTCCTTTTCTCTCTGG + Intergenic
1129091761 15:73158187-73158209 AGAGTCTCACTCTTTCTCCCAGG - Intronic
1130484868 15:84393158-84393180 AGAGTGTCACTCTGTGTCTCAGG - Intergenic
1132005080 15:98219245-98219267 AGATGGTGGCCCCTTCTCTCAGG - Intergenic
1132046904 15:98571714-98571736 AGAGTCTCACTCTCTCTCTCAGG + Intergenic
1132403032 15:101525431-101525453 AGAGGGTAACTCCTGGTTTCTGG + Intergenic
1133005163 16:2876455-2876477 AGAGTTTCACTCCATCACTCAGG - Intergenic
1133906706 16:10029080-10029102 AGAGGGCCACTCCAGCTCTGGGG - Intronic
1134825977 16:17284754-17284776 AGAGTCTCACTCCGTCACTCAGG - Intronic
1136598955 16:31271376-31271398 AGAATCTCACTCTTTCTCTCAGG + Intronic
1136870719 16:33804988-33805010 AGAGTGTCACTCTGTCACTCAGG - Intergenic
1137364581 16:47849560-47849582 AGAGGTTTACTCCTTATCTATGG - Intergenic
1137511741 16:49106714-49106736 AGAGTCTCACTCCATCTCCCAGG - Intergenic
1137689639 16:50413558-50413580 AGAGTTTCACTCTTTCTCCCAGG - Intergenic
1141918168 16:87114977-87114999 AGCGGGTTGCTTCTTCTCTCTGG - Intronic
1141956120 16:87372584-87372606 AGAGTCTCACTCCATCACTCAGG + Intronic
1203101453 16_KI270728v1_random:1311070-1311092 AGAGTGTCACTCTGTCACTCAGG + Intergenic
1142819354 17:2452884-2452906 AGAGGCTCACTCTGTCTCCCAGG + Intronic
1142894469 17:2965009-2965031 AGTGGGTCACTCCCTGGCTCGGG - Intronic
1144544098 17:16176292-16176314 AGAGTGTCACTCTGTCTCCCAGG + Intronic
1146082863 17:29797860-29797882 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1146654073 17:34625123-34625145 ATAGGGTCTCCCCTCCTCTCTGG - Intronic
1146678243 17:34788619-34788641 AGATGGTCTGTCCCTCTCTCAGG - Intergenic
1146866342 17:36338087-36338109 CAAGGGCCGCTCCTTCTCTCAGG + Intronic
1147069212 17:37938699-37938721 CAAGGGCCGCTCCTTCTCTCAGG + Intergenic
1147080740 17:38018236-38018258 CAAGGGCCGCTCCTTCTCTCAGG + Intronic
1147096683 17:38142196-38142218 CAAGGGCCGCTCCTTCTCTCAGG + Intergenic
1147464675 17:40602004-40602026 AGAGTGTCACTCTGTCACTCAGG + Intergenic
1148604439 17:48918357-48918379 AGAGTCTCACTCCATCACTCAGG + Intronic
1148995124 17:51702776-51702798 AGAGGGTCCCTGGTTCTCTCAGG + Intronic
1149214776 17:54340975-54340997 CAAGGGTCTCTCCTTCTCTCTGG + Intergenic
1149731042 17:58946481-58946503 ACAGGGTCTCTCTGTCTCTCGGG + Intronic
1149732152 17:58956408-58956430 AGAGTTTCACTCTTTCTCCCAGG - Intronic
1149845124 17:60004771-60004793 CAAGGGCCGCTCCTTCTCTCAGG - Intergenic
1150909745 17:69375614-69375636 ACAGGGTCTCACTTTCTCTCAGG + Intergenic
1151056408 17:71036998-71037020 AAGGAGTCATTCCTTCTCTCTGG - Intergenic
1151439977 17:74122138-74122160 AGAGTCTCACTCCATCACTCAGG - Intergenic
1151687606 17:75658020-75658042 AGAGTCTCACTCCGTCGCTCAGG - Intronic
1153201170 18:2649125-2649147 AGAGTCTCATTCCGTCTCTCAGG - Intergenic
1157608370 18:48940321-48940343 AGAGAGTCACTGCTTCTTCCTGG + Intronic
1157872185 18:51240510-51240532 AGAGTCTCACTCCATCACTCAGG - Intergenic
1157939398 18:51910703-51910725 ATAGAGTCACTCTGTCTCTCTGG + Intergenic
1158452457 18:57579220-57579242 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1159506476 18:69343599-69343621 AGTGGATCATTCATTCTCTCAGG + Intergenic
1159976927 18:74725159-74725181 AGAGTTTCACTCCTTCGCCCAGG + Intronic
1160329236 18:77977229-77977251 CCAGGGCCACCCCTTCTCTCTGG - Intergenic
1160521289 18:79509557-79509579 AGAGGGGCACCCCTGCTCCCAGG + Intronic
1160878314 19:1308223-1308245 GCAGGGTCTCTCCCTCTCTCAGG - Intergenic
1161260671 19:3336091-3336113 AGCAGGTCACTCCTTTTCTCTGG + Intergenic
1161559098 19:4961178-4961200 ACAGGATCAGTCCTTCTCTCGGG + Exonic
1161582417 19:5088102-5088124 ACAGGCTCCCTCCTGCTCTCCGG - Intronic
1162356608 19:10189443-10189465 AGAGTCTCACTCCTTCACCCAGG + Intronic
1165188833 19:34045069-34045091 AGAGTTTCACTCCATCACTCAGG - Intergenic
1165890049 19:39106547-39106569 ACAGTGTCACTCCGTCTCCCAGG + Intronic
1166875894 19:45897087-45897109 AGAGGCTCACTCCATCACCCAGG + Intronic
1167374521 19:49103783-49103805 AGAGGCTCACTGCTGCTCTCGGG - Intronic
1167829816 19:52010050-52010072 AGAGTCTCACTCTGTCTCTCAGG - Intergenic
1168180342 19:54658377-54658399 AGAGGGTCTCTCCTTCACCCAGG + Intronic
1168191447 19:54741312-54741334 AGAGTCTCACTCCTTCACCCAGG - Intronic
1168197672 19:54787530-54787552 AGAGTCTCACTCCTTCACCCAGG - Intronic
1168204146 19:54836909-54836931 AGAGTCTCACTCCTTCACCCAGG - Intronic
1168295550 19:55375889-55375911 AGAGTCTCACTCCTTCACCCAGG + Intergenic
925849824 2:8069254-8069276 AGAGTCTCGCTCCTTCTCCCAGG - Intergenic
925912632 2:8583478-8583500 GCAGGGTCACACCCTCTCTCTGG - Intergenic
926681475 2:15667060-15667082 TGAGTGCCTCTCCTTCTCTCTGG - Intergenic
927717193 2:25360404-25360426 CCAGGGTCTGTCCTTCTCTCAGG + Intergenic
928333618 2:30377067-30377089 GGACGGTCACTCCACCTCTCTGG - Intergenic
928441156 2:31293280-31293302 AGTAAGTCACTCCTGCTCTCAGG + Intergenic
928501514 2:31901345-31901367 AGAGTCTCACTCTTTCGCTCAGG - Intronic
932827938 2:74958714-74958736 AGCAGGTCCCTCCTCCTCTCGGG - Exonic
932985598 2:76722727-76722749 AGAGTCTCACTCTTTCTCCCAGG - Intergenic
933425648 2:82109276-82109298 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
933665382 2:84960553-84960575 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
933835969 2:86245788-86245810 AGAGTCTCACTCCGTCTCCCAGG + Intronic
936528958 2:113261842-113261864 AGAGTTTCACTCTTTCACTCAGG + Intronic
937340578 2:121088286-121088308 GGAGTGTCACTCTGTCTCTCAGG - Intergenic
937532512 2:122846188-122846210 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
938075031 2:128327411-128327433 AGAGGGGCAGTCCTGCTCCCAGG + Intergenic
939155465 2:138519764-138519786 AGAGTCTCACTCCGTCACTCAGG - Intronic
939317085 2:140565993-140566015 ACAGTGTCACTCCTTCTCTGGGG - Intronic
939440450 2:142242475-142242497 AGAGGGTCACTCCTAATCACTGG - Intergenic
940422548 2:153497561-153497583 AGAGTTTCACTCCGTCTCCCAGG + Intergenic
940839237 2:158559890-158559912 AGAGTCTCACTCTTTCTCCCAGG + Intronic
940918203 2:159281262-159281284 ACAGGGTCACTCAGTCACTCAGG + Intronic
941377923 2:164753765-164753787 AGAGGCTCACTCCGTCACCCAGG + Intronic
942263712 2:174198753-174198775 AGAGGCTCACTCCATCACCCAGG - Intronic
944795087 2:203176197-203176219 AGAGTCTCACTCCTTCACCCAGG + Intronic
945977549 2:216282486-216282508 ACAGTCTCACTCCTCCTCTCTGG - Intronic
946176152 2:217922969-217922991 AAAGGCTCTCGCCTTCTCTCCGG + Intronic
946275309 2:218627233-218627255 AGAGTCTCACTCCGTCTCCCAGG - Intronic
948095174 2:235327659-235327681 AGAGGCTGACTCCGTCACTCAGG + Intergenic
1169196044 20:3682345-3682367 AGCGGTTCTCTCCTCCTCTCAGG - Intergenic
1169484673 20:6018188-6018210 AGAGTCTCACTCCATCACTCGGG - Intronic
1169901472 20:10557043-10557065 AGCTGGTTACTCCTGCTCTCTGG - Intronic
1169926052 20:10785398-10785420 AGAGTCTCACTCCATCACTCAGG + Intergenic
1170191271 20:13647712-13647734 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
1170448504 20:16456522-16456544 AGAGGGTCCCACCTTCCATCAGG - Intronic
1170501061 20:16975318-16975340 AGAGGGTAGCTCCTGCTCTGCGG - Intergenic
1170650156 20:18231794-18231816 AGAGTGTCACTCCATCACCCAGG - Intergenic
1171176545 20:23054334-23054356 GGAGAGTCACTGATTCTCTCTGG - Intergenic
1171178601 20:23074615-23074637 GGATGGTGAGTCCTTCTCTCAGG + Intergenic
1173101720 20:40094378-40094400 AGAGTCTCACTCCTTCGCCCAGG + Intergenic
1173122103 20:40302946-40302968 AGAGTCTCACTCCGTTTCTCAGG - Intergenic
1174595373 20:51679296-51679318 AGAGTGTCACTCCGTCACCCAGG - Intronic
1174613947 20:51821602-51821624 AGGGTGTCACTCCATCACTCAGG + Intergenic
1175127440 20:56763048-56763070 AAAGGGCCACTCCTACTGTCTGG + Intergenic
1175335228 20:58191561-58191583 AGAGACTTTCTCCTTCTCTCTGG + Intergenic
1175487913 20:59358616-59358638 AGATGGACATTCCTTTTCTCTGG + Intergenic
1176238839 20:64066673-64066695 AGAGGGTCTCTGCCTTTCTCTGG + Intronic
1176422470 21:6527285-6527307 AGAGTCTCACTCCGTCACTCAGG - Intergenic
1177070739 21:16503554-16503576 AGAGTTTCACTCTTTCTCCCAGG - Intergenic
1177134707 21:17296757-17296779 AGAGGGTCAGCCCTTCCCTGGGG + Intergenic
1177493126 21:21854115-21854137 AGAGTCTCACTCCGTCTCCCAGG - Intergenic
1179095132 21:38307636-38307658 AGAGTCTCACTCCATCCCTCAGG + Intergenic
1179697961 21:43135601-43135623 AGAGTCTCACTCCGTCACTCAGG - Intergenic
1179848274 21:44123261-44123283 ACAGGGTCGCTACTTCTTTCTGG - Intronic
1180883997 22:19226761-19226783 AGAGTCTCACTCCATCACTCAGG + Intronic
1181144081 22:20831540-20831562 AGAGTCTCACTCCATCACTCAGG - Intronic
1182102704 22:27669376-27669398 AGTGGGTCACTTCCCCTCTCTGG + Intergenic
1182744972 22:32598509-32598531 AGAGTCTCACTCTTTCGCTCAGG + Intronic
1183789738 22:40056770-40056792 AGGGTGTCACTCTGTCTCTCAGG - Intronic
1184187388 22:42873817-42873839 AGAGTGTCACTCCATCACCCAGG + Intronic
949289742 3:2450339-2450361 AGAGTCTCACTCCTTCACCCAGG - Intronic
949557945 3:5174826-5174848 ACAGTGTCACTCCTTCACCCAGG + Intronic
950551996 3:13671815-13671837 TCAGGGTCAATCCATCTCTCTGG - Intergenic
950836530 3:15924949-15924971 AGAGTCTCACTCCATCACTCAGG - Intergenic
951609013 3:24470640-24470662 AGAGTGTCACTTCTTCTCCCAGG + Intronic
952525255 3:34203269-34203291 AGAGGGCTTTTCCTTCTCTCAGG + Intergenic
952533708 3:34288665-34288687 AGACAGACAGTCCTTCTCTCTGG - Intergenic
952925812 3:38318465-38318487 GCAGGGTCAGTCCTTCTCCCAGG + Exonic
954184667 3:48907696-48907718 AGAGGCTCACTCTTTCCCCCAGG + Intergenic
954622627 3:52004736-52004758 AGAGGGTCACTCCTTCCGGTAGG - Intergenic
954717964 3:52536287-52536309 AGAGGGTCATCACTTCTATCTGG + Intronic
955079941 3:55649284-55649306 AGAGGCTCACTCTGTCTCCCAGG + Intronic
955380358 3:58433574-58433596 GGAGGGTCCCCCCTTCTCTCGGG - Intronic
955597593 3:60608481-60608503 AGAGGTTCAGTCCAGCTCTCTGG + Intronic
956095570 3:65712536-65712558 AGAGTTTCACTCCGTCACTCAGG + Intronic
956310290 3:67871123-67871145 AGAGTCTCACTCTTTCACTCAGG - Intergenic
956742834 3:72288484-72288506 AGAGGGTCGCTTCACCTCTCAGG - Intergenic
959676211 3:109038940-109038962 AGAGTCTCACTCCTTCACTCAGG + Intronic
959990122 3:112622019-112622041 AGCAAGTCACTCCTCCTCTCAGG - Intronic
960450324 3:117798910-117798932 AGATAGTCACTCCTTCCTTCAGG + Intergenic
961028293 3:123580448-123580470 AGAGGGTCACTCTGTCACCCAGG - Intronic
961566460 3:127767045-127767067 AGAGTCTCACTCCATCACTCGGG - Intronic
961636023 3:128333361-128333383 ACATGGGCACTCCTTCTGTCAGG - Intronic
962388126 3:134949334-134949356 TCATGGTCACTCCTTCTGTCTGG - Intronic
962512965 3:136120560-136120582 AGAGTCTCACTCTGTCTCTCAGG - Intronic
962841071 3:139233065-139233087 GGAGAGTCACGGCTTCTCTCTGG + Intronic
963654113 3:148023922-148023944 TGATGGTCACTCCTTCTTTAGGG + Intergenic
964407640 3:156366204-156366226 GTATGTTCACTCCTTCTCTCCGG + Intronic
965303717 3:167037103-167037125 AGAGTCTCACTCCTTCACCCAGG - Intergenic
966026374 3:175288105-175288127 AGAGTCTCACTCCGTCTCCCAGG + Intronic
967062973 3:185888976-185888998 AGAGTCTCACTCCGTCTCCCAGG - Intergenic
967360324 3:188623281-188623303 AGAGCGTCACTCTATCTCCCAGG + Intronic
969143721 4:5102077-5102099 ACTGGTTCACTCCTTATCTCTGG - Intronic
969238782 4:5886627-5886649 AGAAGGTCTCTGCTGCTCTCAGG - Intronic
973637783 4:52876026-52876048 AGAGGGTCTCTACGTCTTTCAGG + Intronic
973767701 4:54178832-54178854 AGAGTTTCACTCTTTCTCTCAGG - Intronic
973799005 4:54458469-54458491 AGAGGCTCACTCTGTCACTCAGG + Intergenic
973833431 4:54785055-54785077 AGTGAGTCATTCATTCTCTCTGG + Intergenic
974191070 4:58504690-58504712 AGAGTCTCACTCCTTCACCCAGG + Intergenic
978216101 4:106205734-106205756 AGAGTCTCACTCCATCACTCAGG - Intronic
978218776 4:106243710-106243732 ACAGGGTCTCTCATTCACTCAGG + Intronic
978585069 4:110268448-110268470 AGAGTCTCACTCCTTCACTCAGG - Intergenic
978965319 4:114734022-114734044 AGAGTGTCACTCCGTCACTCAGG + Intergenic
979073350 4:116240352-116240374 AGAGTGTCTCTCTTGCTCTCTGG + Intergenic
979908754 4:126332951-126332973 AGAGTCTCACTCCTTCCCCCAGG - Intergenic
980741986 4:136963393-136963415 ATAGCTTCCCTCCTTCTCTCTGG - Intergenic
981874767 4:149529087-149529109 AGAGTCTCACTCCATCACTCAGG + Intergenic
982024092 4:151234771-151234793 AGGGGCTCACTCCGTCACTCAGG + Intronic
982914346 4:161186829-161186851 AGAGGGTTACTTCTTTTTTCTGG + Intergenic
982949060 4:161665265-161665287 AGAGTCTCACTCCTTCACCCAGG + Intronic
983199892 4:164849973-164849995 AGAGTCTCACTCTATCTCTCAGG - Intergenic
983323813 4:166227741-166227763 AGTGGGTAGCTCCTTTTCTCAGG - Intergenic
983362093 4:166739264-166739286 AGAGTCTCACTCCATCACTCAGG + Intronic
984107124 4:175561916-175561938 ACAAGGTCTCTCCTTTTCTCTGG + Intergenic
984453061 4:179928375-179928397 ACAGGGTCACTCCTTGACTATGG + Intergenic
984788964 4:183596301-183596323 TGAGGGTCATTCCTTCTAACAGG + Intergenic
986999824 5:13648849-13648871 AGAGGGGCATTCGTTCTGTCAGG - Intergenic
988629056 5:32909749-32909771 GGAGGGCCACTTCTACTCTCCGG - Intergenic
989585345 5:43070330-43070352 AGAGTGTCACTCTGTCTCCCAGG + Intronic
990586527 5:57216658-57216680 AGAGTCTCACTCCTTCACCCAGG - Intronic
991471748 5:66976266-66976288 ATAGGCTCACTCCTTCTTCCTGG + Intronic
992169305 5:74086314-74086336 AGAAGGCTTCTCCTTCTCTCAGG + Intergenic
994670156 5:102754717-102754739 AATGGGTCCTTCCTTCTCTCGGG + Intronic
994886568 5:105570394-105570416 AGAGTCTCACTCTTTCTCCCAGG - Intergenic
995616366 5:113968885-113968907 AGAAGGCCACGGCTTCTCTCTGG - Intergenic
996352019 5:122554523-122554545 AGGTGTTGACTCCTTCTCTCTGG - Intergenic
996488459 5:124064625-124064647 AGAGTCTCACTCCTTCACCCAGG - Intergenic
996587570 5:125107643-125107665 AGAGGGTGTCTCCTTATTTCTGG + Intergenic
998867209 5:146517390-146517412 AGAGGATCACTCTGTCACTCAGG - Intergenic
999062309 5:148649100-148649122 AGAGAGACAATACTTCTCTCAGG + Intronic
999387179 5:151162337-151162359 AGAGTCTCACTCTGTCTCTCAGG - Intergenic
999547238 5:152643128-152643150 AGAGTGCAACTCCTTTTCTCTGG - Intergenic
1000729053 5:164808618-164808640 AGAGTCTCACTCTTTCTCCCTGG + Intergenic
1000976770 5:167773747-167773769 AGCAGATCACTCCATCTCTCTGG - Intronic
1001429532 5:171648329-171648351 TGAGAGTAACTCCATCTCTCTGG - Intergenic
1001601664 5:172932886-172932908 AGACAGACACTCCTGCTCTCAGG + Intronic
1001714326 5:173802613-173802635 AGAGTCTCACTCTCTCTCTCAGG - Intergenic
1002036223 5:176472154-176472176 AGAGTCTCACTCCGTCTCCCAGG + Intronic
1003698562 6:8437485-8437507 AGAGGCTCACTCTGTCGCTCAGG + Intergenic
1004160543 6:13209072-13209094 AGAGGGCCTCTCTTTCTCTGGGG - Intronic
1005138527 6:22599851-22599873 AGAGGACCACACCTCCTCTCGGG - Intergenic
1005581352 6:27238209-27238231 GGAGAGTTACTCCTTCTCTCTGG + Intergenic
1005851977 6:29828985-29829007 TGAGGGTCCGTCCTGCTCTCTGG + Intronic
1006968834 6:38018986-38019008 AGAGTGTCACTCTGTCACTCAGG + Intronic
1007248097 6:40476778-40476800 TGTGGGTCACGCCTGCTCTCAGG - Intronic
1008028894 6:46670760-46670782 AGAGTCTCACTCTGTCTCTCAGG + Intronic
1008869813 6:56260026-56260048 AGTGGGTCACACCTACCCTCTGG - Intronic
1009955761 6:70450764-70450786 AGAGTCTCACTCTGTCTCTCAGG + Intronic
1013256880 6:108396514-108396536 AGAGTCTCACTCTTTCGCTCAGG + Intronic
1013451072 6:110281621-110281643 AGAGTCTCACTCCATCGCTCAGG - Intronic
1013537655 6:111077915-111077937 AGAGTCTCACTCTTTCTCCCAGG - Intergenic
1014869363 6:126573016-126573038 AGAGTCTCACTCTATCTCTCAGG + Intergenic
1016223780 6:141708696-141708718 AGAGGGCTATTCCTCCTCTCTGG - Intergenic
1017449807 6:154544327-154544349 AGAGTCTCACTCCTTCACCCAGG - Intergenic
1018016826 6:159720054-159720076 AGAGTCTCACTCCGTCTCCCAGG + Intronic
1018188691 6:161289696-161289718 AGAGTCTCACTCCGTCACTCAGG - Intergenic
1020372172 7:7444243-7444265 AATAGGCCACTCCTTCTCTCAGG + Intronic
1020947075 7:14624970-14624992 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1020998966 7:15303516-15303538 AGGGGGTCATTTCTTCTCACTGG - Intronic
1021074245 7:16280992-16281014 AGAGTCTCACTCCGTCACTCAGG - Intronic
1021547089 7:21825931-21825953 AGAGTCTCACTCCTTCGCCCAGG - Intronic
1022975637 7:35553453-35553475 AGTGTGTCTCTTCTTCTCTCTGG + Intergenic
1023904232 7:44510693-44510715 AGAAGCTCACTCTTTCACTCAGG + Intergenic
1023927169 7:44677856-44677878 AGAGGGAGACTCCTTCTCAAAGG + Intronic
1024002751 7:45201886-45201908 TCAGGGACCCTCCTTCTCTCAGG + Intergenic
1024016875 7:45325379-45325401 AGTGGGGCACTGTTTCTCTCTGG + Intergenic
1024021112 7:45371549-45371571 AGAGGGTCACTTCATCTTTAAGG - Intergenic
1024259788 7:47565390-47565412 AGAGGCTCACTCTTTCGCCCAGG + Intronic
1024861033 7:53841785-53841807 ACAGTGTCACTCTGTCTCTCAGG + Intergenic
1025203094 7:56974267-56974289 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
1026002673 7:66574067-66574089 AGAGTGTCACTCCATCACCCAGG + Intergenic
1026029186 7:66774732-66774754 AGAGTGTCACTCCATCGCCCAGG - Intronic
1026034849 7:66823658-66823680 AGAGTGTCACTCTGTCTCCCAGG - Intergenic
1026266971 7:68804017-68804039 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
1027203303 7:76076637-76076659 ACAGGGTCACTCTGTCACTCAGG + Intergenic
1027761001 7:82278530-82278552 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1028174246 7:87634599-87634621 AGAGTCTCACTCTTTCTCCCAGG - Intronic
1028230658 7:88302926-88302948 ACAGTCTCACTCCTTCACTCAGG - Intronic
1029064998 7:97840541-97840563 ATAAGGACACTCCTTTTCTCTGG - Intergenic
1029549265 7:101228633-101228655 AGAGTGTCACTCTGTCGCTCAGG + Intergenic
1030068228 7:105676812-105676834 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1031361790 7:120857263-120857285 AGAAGGGCGCTCATTCTCTCGGG - Intronic
1031378177 7:121052745-121052767 AGAGTCTCACTCTGTCTCTCAGG + Intronic
1032752848 7:134859125-134859147 AGATGGCCACTTCTTCTCCCTGG + Intronic
1032793323 7:135258376-135258398 AGAGGGTCACTTTTTATCTGTGG - Intronic
1034005589 7:147468864-147468886 AGAGTGTCACTCTTTCACCCAGG + Intronic
1034011681 7:147535364-147535386 AGAGTCTCACTCTTTCGCTCAGG - Intronic
1034494705 7:151412438-151412460 AGAGGGTCACTCTTTCCAGCAGG - Intergenic
1034900369 7:154904716-154904738 AGAGTGTCACACCTACTCACTGG - Intergenic
1036089134 8:5646225-5646247 AGGCTGTCTCTCCTTCTCTCTGG - Intergenic
1036275992 8:7352466-7352488 AGAGTCTCACTCCGTCGCTCAGG + Intergenic
1036442313 8:8792209-8792231 AGAGTCTCACTCCTTCACCCAGG - Intronic
1037951970 8:23024544-23024566 AGAGTCTCACTCCGTCTCCCAGG + Intronic
1038960056 8:32508759-32508781 AGAGTCTCACTCCGTCACTCAGG + Intronic
1039571458 8:38589920-38589942 AGGGTTTCACTCTTTCTCTCAGG + Intergenic
1041812897 8:61931700-61931722 AGGGTGACACACCTTCTCTCGGG - Intergenic
1045061635 8:98416498-98416520 AGAGGACCGCTCCTTCTCTCAGG + Intronic
1045531378 8:102988326-102988348 AGAGTATCACTCTTTCTCCCAGG - Intergenic
1047215240 8:122870766-122870788 AGAGGGTCACTCCTTCTCTCTGG - Intronic
1047997920 8:130354533-130354555 AGAGGGTCCCTTCTACTGTCTGG + Intronic
1048170134 8:132098485-132098507 AAAGTCTCACTCTTTCTCTCAGG + Intronic
1048338363 8:133519922-133519944 AGAGTCTCACTCTTTCACTCAGG - Intronic
1048389670 8:133950112-133950134 AGAGTCTCACTCAGTCTCTCAGG - Intergenic
1048662071 8:136616060-136616082 AGAGTCTCACTCCGTCACTCAGG + Intergenic
1049147761 8:141014213-141014235 AGAGGCTCACTCTTTCACCCAGG + Intergenic
1049658153 8:143807954-143807976 AAAGGGTCTCACCTGCTCTCTGG - Intronic
1049811833 8:144578818-144578840 ACAGGGTCTCTCTTTGTCTCTGG - Intronic
1049848120 8:144814424-144814446 AGAGTCTCACTCTTTCTCCCAGG - Intergenic
1050355398 9:4778082-4778104 AGAGTCTCACTCCGTCACTCAGG - Intergenic
1051618512 9:19029358-19029380 AGTGAGTCACTGGTTCTCTCTGG - Intronic
1052966931 9:34347360-34347382 AGAGTGAAACTCCATCTCTCGGG - Intergenic
1055577846 9:77677932-77677954 AAAGTCTCACTGCTTCTCTCTGG - Intergenic
1057204905 9:93165589-93165611 AGAGTCTCACTCTGTCTCTCAGG + Intergenic
1057632913 9:96735473-96735495 AGAGGGAGACTCCTTCTCAGGGG - Intergenic
1057799038 9:98178604-98178626 AGAGTGTTTCCCCTTCTCTCTGG + Intronic
1058954545 9:109933332-109933354 AGAGTGACACCCCTTCCCTCTGG + Intronic
1059000342 9:110341993-110342015 AGAGTGTCACTCTTTCACCCAGG - Intergenic
1059561878 9:115342778-115342800 AGATGGTCACTGCATCTCTGGGG + Intronic
1059831119 9:118097274-118097296 AGAGGTTCACTCTGTCTCCCAGG + Intergenic
1060977543 9:127773890-127773912 AGAGTGTCGCTCTGTCTCTCAGG - Intronic
1061075879 9:128341016-128341038 AGAGGGTGACTAGTTCCCTCGGG - Intronic
1061556679 9:131374549-131374571 AGAGTCTCACTCCATCCCTCAGG + Intergenic
1061686705 9:132286292-132286314 AGAGTCTCACTCTGTCTCTCAGG - Intronic
1061750030 9:132770840-132770862 ATGGGGTTACACCTTCTCTCAGG + Intronic
1062167047 9:135113125-135113147 AGAGAGGCCTTCCTTCTCTCTGG + Intronic
1187193263 X:17056667-17056689 AGAGTCTCACTCTTTCTCCCAGG - Intronic
1187697598 X:21937576-21937598 AGAGAGTCATTCCTTATCTATGG + Intergenic
1188436352 X:30163543-30163565 AGAGGGTAACCCATTCTCGCTGG + Intergenic
1189225857 X:39412661-39412683 AGAAGGGCATTCCTACTCTCTGG + Intergenic
1189486681 X:41438599-41438621 AGAGTCTCACTCTATCTCTCAGG - Intergenic
1189524535 X:41805855-41805877 TTAGGGGCACTCCGTCTCTCAGG - Intronic
1189880708 X:45488475-45488497 AGAGTCTCACTCCATCACTCAGG - Intergenic
1190580556 X:51889600-51889622 AGAGTCTCACTCTTTCACTCAGG - Intronic
1190635584 X:52430428-52430450 AGAGTCTCACTCCTTCACCCAGG + Intergenic
1192023264 X:67419149-67419171 AGAGTCTCACTCCGTCTCCCAGG - Intergenic
1193995783 X:88364887-88364909 TGAGGATCACCCCTTCTCTTAGG + Intergenic
1194076651 X:89402372-89402394 AGAATGTCACCCGTTCTCTCTGG - Intergenic
1194525034 X:94967803-94967825 AGAGGTTTACTCCTGCTCTATGG + Intergenic
1194796003 X:98211401-98211423 AGAGGGAGACTCCATCTGTCTGG + Intergenic
1196385391 X:115143067-115143089 AGAGTCTCACTCTTTCTCCCAGG - Intronic
1197258032 X:124285344-124285366 GGAGTCTCACTCTTTCTCTCAGG + Intronic
1198381093 X:136084304-136084326 AGAGTCTCACTCCTTCTCTCAGG + Intergenic
1199087143 X:143640378-143640400 ACAGGGTCACTCTGTCGCTCAGG - Intergenic
1199726401 X:150586886-150586908 AGAGTGTCACTCTGTCGCTCAGG - Intronic
1200293276 X:154892085-154892107 AGAGTTTCACTCCTTCCCACCGG + Intronic
1200429293 Y:3057895-3057917 AGAATGTCACCCGTTCTCTCTGG - Intergenic
1201074581 Y:10177408-10177430 AGAGTCTCACTCTTTCGCTCAGG + Intergenic