ID: 1047215241

View in Genome Browser
Species Human (GRCh38)
Location 8:122870783-122870805
Sequence CTGTGACTGCTCAGTTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215241_1047215248 29 Left 1047215241 8:122870783-122870805 CCCTCTCAACTGAGCAGTCACAG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1047215248 8:122870835-122870857 GCACCAATTCAGAGAAAGAATGG No data
1047215241_1047215245 -8 Left 1047215241 8:122870783-122870805 CCCTCTCAACTGAGCAGTCACAG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1047215245 8:122870798-122870820 AGTCACAGCAGAAATGGAGTGGG No data
1047215241_1047215244 -9 Left 1047215241 8:122870783-122870805 CCCTCTCAACTGAGCAGTCACAG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215241_1047215246 -7 Left 1047215241 8:122870783-122870805 CCCTCTCAACTGAGCAGTCACAG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1047215246 8:122870799-122870821 GTCACAGCAGAAATGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215241 Original CRISPR CTGTGACTGCTCAGTTGAGA GGG (reversed) Intronic
900000484 1:12335-12357 CTGTGACTGCTCAGACCAGCCGG + Intergenic
900020197 1:182854-182876 CTGTGACTGCTCAGACCAGCCGG + Intergenic
902756663 1:18553392-18553414 CTCTGACTGCCCTGTGGAGAGGG - Intergenic
908420755 1:63956273-63956295 CTGGGACTGATCAGCTGAGGAGG - Intronic
908421867 1:63966638-63966660 TTAAGACTGCTTAGTTGAGATGG - Intronic
909085119 1:71161464-71161486 GTGTGGGTGCTCAGTTGACAAGG - Intergenic
909916495 1:81325742-81325764 CTGGGAGTGCTGGGTTGAGAGGG - Intronic
915642427 1:157239113-157239135 CTGTGTGTGCTCAGTTGCAAAGG - Intergenic
917155136 1:171989155-171989177 GTGTGACTACTAAGATGAGAAGG + Intronic
920758328 1:208757003-208757025 CTGTGACTGGACAGGAGAGAAGG + Intergenic
921234454 1:213111042-213111064 CTGTGACCACTCAGCTGGGATGG + Intronic
1063963560 10:11327150-11327172 GTGTGACAGTTCAGTAGAGAGGG + Intronic
1064571907 10:16702416-16702438 CTGTGACTGCTCTATTGGGCTGG - Intronic
1067826067 10:49573958-49573980 CTGTGGCTGGTCAGATGAGGGGG + Intergenic
1069180362 10:65351275-65351297 CTGTGACTGCCAAGTAGAGCTGG - Intergenic
1069630759 10:69895703-69895725 CTCTGACTGCTGAGTGCAGAGGG - Intronic
1071044391 10:81355971-81355993 CTGTGGTGGCTGAGTTGAGAGGG - Intergenic
1071755358 10:88531997-88532019 CTTTTACTGCTAAGTAGAGATGG - Intronic
1077325942 11:1964157-1964179 CTGTGACTGGTCAGTTCTGCCGG - Intronic
1081608278 11:44541450-44541472 CTCTGACTGCTGAGAGGAGAAGG + Intergenic
1081709544 11:45208056-45208078 CTCTGGCTGCTCAGTTGAGAGGG + Intronic
1084335493 11:68455355-68455377 CTGTCACTGCAGAGGTGAGAGGG - Intergenic
1085771368 11:79329012-79329034 CTGGGACAGGTCAGTTGGGATGG - Intronic
1088795466 11:113263825-113263847 CTGTGTGTGCTCAGTAGAGAAGG + Intronic
1090020458 11:123123845-123123867 CTGTGGCAGCTCAGAGGAGATGG + Intronic
1091088078 11:132743059-132743081 ATGTGACTGATCAGATGATAGGG + Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1202808922 11_KI270721v1_random:19336-19358 CTGTGACTGGTCAGTTCTGCCGG - Intergenic
1093059279 12:14586921-14586943 CTGTGAGTGCCCATTTAAGAAGG - Intergenic
1093906276 12:24695812-24695834 CTGTGACTGCTTAGCTGAACTGG - Intergenic
1094070923 12:26412231-26412253 CTGTGACTAATCAGCTGAGATGG + Intronic
1094074482 12:26457766-26457788 CTGTGGCTGTTCAGTTAACAAGG - Intronic
1095966517 12:47870736-47870758 CTGTGACAGTGCAGTGGAGATGG - Intronic
1096587341 12:52631402-52631424 CTGAGTCTGCAGAGTTGAGACGG + Intergenic
1096664131 12:53151033-53151055 CTGTGACTGCTCTGCAGAGCAGG + Intergenic
1100960763 12:99960499-99960521 CTGACACAGCTGAGTTGAGAAGG + Intronic
1103999805 12:124853275-124853297 GTGAGAATGCTGAGTTGAGATGG + Intronic
1104082307 12:125440878-125440900 CTGTGGCTGCTCAGTGTAGAAGG + Intronic
1105999217 13:25703797-25703819 CAGTGACTGCTCAGTGGGCATGG + Intronic
1111529257 13:89515506-89515528 CTCTATCTGCTCAGTGGAGAGGG + Intergenic
1114195132 14:20470068-20470090 AAGTGACTGCTAAGTGGAGACGG + Intronic
1116049412 14:39784985-39785007 CTCTCACTCCTCAGTTTAGAGGG - Intergenic
1117503866 14:56381327-56381349 CTGTGTCTTCCCAGTTGATAGGG - Intergenic
1118637177 14:67758572-67758594 CTGTGAATGCTCAACAGAGAGGG + Intronic
1119739457 14:77004825-77004847 AGGTGTCTGCTCAGTTGAGGGGG + Intergenic
1119782940 14:77290180-77290202 TTGTGACTTCTGAGTTAAGATGG - Intronic
1121778155 14:96604450-96604472 GTGTGACTGTCTAGTTGAGAAGG + Intergenic
1124217974 15:27825356-27825378 CTGTCCCTGCTGAGTTGAAATGG - Intronic
1126322327 15:47438341-47438363 CTGTGGCTGCTGTGTTGAGATGG - Intronic
1126569483 15:50134947-50134969 CTGTGACTCATCAGATGTGAGGG + Intronic
1131148337 15:90030644-90030666 ATGTGACTGCCCTGTTGGGAAGG - Intronic
1131254874 15:90855411-90855433 CTGTGACTGGACAGTTGGGCCGG - Intergenic
1132453023 15:101978610-101978632 CTGTGACTGCTCAGACCAGCCGG - Intergenic
1132453869 16:12016-12038 CTGTGACTGCTCAGACCAGCCGG + Intergenic
1132720886 16:1315101-1315123 CTGGGACTGCTCAGCTCAGGGGG - Intronic
1132746226 16:1437475-1437497 GTGTAACAGCTCTGTTGAGATGG - Intronic
1133264099 16:4572890-4572912 CTGTGACTCATCAGTTGTGACGG - Intronic
1133996223 16:10750649-10750671 CTGGGACTGCAGAGCTGAGAGGG + Intronic
1135184361 16:20302181-20302203 CTGTGACTTCGCTGTTGACAAGG - Intergenic
1138196782 16:55057965-55057987 CCTTGACTGCTCGGTTCAGAAGG - Intergenic
1139296865 16:65908769-65908791 CTGTGACAGCTCTGTTGCCATGG - Intergenic
1141083987 16:81078136-81078158 CTGTGATTGCTCCAATGAGACGG + Intergenic
1142878913 17:2869550-2869572 CTGTGAATGCTCAGCTGAGTTGG + Intronic
1145281076 17:21467508-21467530 CTGTGTCTTCTCAGAAGAGATGG - Intergenic
1145396874 17:22503398-22503420 CTGTGTCTTCTCAGAAGAGATGG + Intergenic
1149563272 17:57624714-57624736 CTGTGACTGCAAATTTGGGAAGG + Intronic
1150304466 17:64072594-64072616 CTGGGACTGGTCAGTGGAGTTGG + Intronic
1150620001 17:66801051-66801073 GTGTGACAGCTCAGTAGAGTCGG - Intronic
1151511530 17:74563866-74563888 CTGTGGCTGCTCTGCAGAGATGG + Intergenic
1151951376 17:77356115-77356137 CTGTGATTGGTCACCTGAGAGGG - Intronic
1156453295 18:37278834-37278856 CTGTGGCTGGCCAGCTGAGATGG + Intronic
1157104435 18:44760021-44760043 CTGACAATGCTCAGCTGAGAAGG - Intronic
1157982803 18:52401327-52401349 CTGTAAATGCTCAGTAGAGATGG - Intronic
1158839767 18:61372749-61372771 CTGTAACTGCAGAGTTGAGTAGG + Intronic
1160311416 18:77794557-77794579 CTGTCCCTGCTCAGGTGAGATGG - Intergenic
1160349671 18:78165757-78165779 GAGTGACTGCTCCGTGGAGATGG - Intergenic
1162203123 19:9035692-9035714 ATGTGACTGCTCAGTGGGCACGG + Intergenic
1163150966 19:15413860-15413882 CTGTGTCTGTTCAGGCGAGAGGG + Intronic
1163834943 19:19567550-19567572 CTGTGCCTGCCCAGGTGGGAGGG + Intronic
928910181 2:36412500-36412522 CTGTCACTGTTCAGTTCAGAGGG + Intronic
929126509 2:38527258-38527280 CTGTGACAGCTGAGTGGGGAAGG + Intergenic
932534092 2:72573389-72573411 CTGTGACTGATCATCTGTGATGG + Intronic
932700688 2:73989254-73989276 CTGTGACTGTTCAGGTGGGGCGG + Intronic
933212771 2:79590160-79590182 CTGTGACTGCTCCTTTGAGGAGG + Intronic
933289917 2:80426552-80426574 CTCTGACTGCTCTGTGCAGAAGG - Intronic
936569239 2:113601082-113601104 CTGTGACTGCTCAGACCAGCCGG - Intergenic
936669601 2:114641391-114641413 TTGTGATTGCTCAGTAGAAAAGG + Intronic
937385747 2:121430651-121430673 CTGTGATGGCTGAGTTAAGAAGG - Intronic
940637597 2:156318301-156318323 CTGTGAATGATCAGGTGAGCAGG - Intergenic
941430962 2:165413434-165413456 CTGTGACTGCTCTCCTTAGAAGG - Intergenic
946345314 2:219105054-219105076 CTGTCACTGCTTGATTGAGAGGG + Intronic
946555837 2:220856136-220856158 CTGTGTCTGCTGAGTCCAGAAGG + Intergenic
947330813 2:229027567-229027589 CTGTGAGTGTTCAGTGGAGGAGG + Intronic
947555221 2:231086333-231086355 CTGTGTCTGGCCAGTTGAAATGG + Intronic
948032326 2:234828969-234828991 CTGTGCCTACTCACTGGAGAGGG - Intergenic
1170342420 20:15344315-15344337 CTGTGCTTTCTCAGTTGGGATGG - Intronic
1174184692 20:48698253-48698275 CTGTCCCTGCACAGGTGAGACGG + Intronic
1174594545 20:51673531-51673553 TTGGGACTGCTGTGTTGAGAAGG - Intronic
1177210549 21:18065870-18065892 CTGTGATGGCACATTTGAGAAGG + Intronic
1177212746 21:18090885-18090907 CTGTGACTGCTCACCTGATTTGG - Intronic
1177348717 21:19906725-19906747 ATGTGACTTCTCAGAAGAGATGG - Intergenic
1177846278 21:26291091-26291113 CTGTGATGGCTCTCTTGAGATGG - Intergenic
1180825368 22:18857610-18857632 CTGTGTCTGCAGAGTTGATAGGG + Intronic
1181187363 22:21116937-21116959 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1181211835 22:21293556-21293578 CTGTGTCTGCAGAGTTGATAGGG + Intergenic
1181397665 22:22633330-22633352 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1181500413 22:23312700-23312722 CTGTGTCTGCAGAGTTGATAGGG - Intronic
1181651740 22:24262728-24262750 CTGTGTCTGCAGAGTTGATAGGG + Intergenic
1181705635 22:24648011-24648033 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1181753394 22:25005780-25005802 CTGTGTCTTCTCTGTTGAGAAGG + Intronic
1182524337 22:30906180-30906202 CTGTGCCTGCCCAGCAGAGAAGG + Exonic
1183113404 22:35669816-35669838 CGGTCACTTGTCAGTTGAGAAGG - Intergenic
1203215118 22_KI270731v1_random:1876-1898 CTGTGTCTGCAGAGTTGATAGGG - Intergenic
1203275515 22_KI270734v1_random:83513-83535 CTGTGTCTGCAGAGTTGATAGGG + Intergenic
950962504 3:17120548-17120570 CTGAGACTGGTCTGATGAGAAGG - Intergenic
953495051 3:43378682-43378704 CTGTTCCTGGCCAGTTGAGAAGG + Intronic
953822718 3:46222200-46222222 CTGTGGCTGCTGTGTTGATATGG - Intronic
954292571 3:49657563-49657585 CAGTGACTGCTCCGTGCAGACGG + Exonic
957838339 3:85630831-85630853 CTCTGACTGCTCTGTGGAGAGGG - Intronic
960569466 3:119171410-119171432 CTGTGTATGTTCATTTGAGAGGG - Intronic
960879960 3:122334191-122334213 GTGTGATTGTTCTGTTGAGATGG - Intronic
961351915 3:126309578-126309600 CTGTGCCTTGTTAGTTGAGAGGG + Intergenic
962128459 3:132647654-132647676 TGGTGACAGCTCAGGTGAGAGGG + Intronic
962357590 3:134708172-134708194 CTTAGAATGCTCATTTGAGAAGG - Intronic
965973393 3:174590137-174590159 TTCTGACTGATCAATTGAGAAGG - Intronic
966084773 3:176056786-176056808 CAGTGACTTCTCAGTTGAAGGGG + Intergenic
966856841 3:184200044-184200066 CTCTGGCTGCTCAGATGTGAGGG + Intronic
967151262 3:186652858-186652880 ATGAGACTGCTCAGTTTAGGAGG - Exonic
967229489 3:187324075-187324097 CTCTGACTGCTGAGTTGAGATGG + Intergenic
967275368 3:187768869-187768891 CTCTGGGTGCTCTGTTGAGAAGG + Intergenic
968137891 3:196232288-196232310 CTGTGACTGCACAGATCTGACGG + Intronic
979230330 4:118341759-118341781 CTGTAACTGCTCAGTTGCTTTGG - Intronic
981436278 4:144726763-144726785 CATTGACGGCTCAGTTGAGAAGG - Intronic
982916328 4:161214215-161214237 CTGAGCCTGCACATTTGAGAGGG + Intergenic
986745284 5:10738388-10738410 CTTTGATTGTTCAGTTAAGATGG - Intronic
986751829 5:10794560-10794582 CTGCCACTGCTCGGTAGAGAAGG + Intergenic
988641931 5:33049830-33049852 ATGTGACTGCTCTGATGTGAAGG - Intergenic
991586310 5:68205732-68205754 CTGTGGCTGTTCACTTGAGCAGG - Intergenic
993769147 5:91903198-91903220 CTGGGACTCCTCAGTTGCAATGG + Intergenic
995000145 5:107118267-107118289 CTGTGTCTGATCATCTGAGATGG - Intergenic
997178287 5:131801342-131801364 CTGTGGCTGTTCTGTGGAGAAGG + Intergenic
998472772 5:142396229-142396251 CTGGGGCTGCTGAGTGGAGATGG + Intergenic
1002077831 5:176719696-176719718 CTCTGACTGCTCAGAAGAGCAGG - Intergenic
1002444283 5:179279673-179279695 CTGGGACTGTTCAGTAGTGAGGG - Intronic
1002787610 6:416043-416065 TTTTTAGTGCTCAGTTGAGAGGG - Intergenic
1002795759 6:469999-470021 CTGATAGTGCTCAGTTAAGAAGG - Intergenic
1006098378 6:31670480-31670502 CTGAGACTGCTCATCTCAGAAGG + Exonic
1009894453 6:69730213-69730235 CTTTTACCGCTCAGTTTAGAAGG + Intronic
1011043214 6:83053605-83053627 CTGTGATTGCCCTGTTGAGATGG - Intronic
1016302314 6:142646084-142646106 CCGTGACTGCTCACAGGAGATGG + Intergenic
1018302965 6:162423191-162423213 CTGTAAGTGCTTAGTTGAGAAGG - Intronic
1019991872 7:4697465-4697487 CTGTGGCTGCTGAGCTGAGCCGG + Intronic
1022558682 7:31326614-31326636 CTGTCACTCCTCATTTGTGAAGG - Intergenic
1023757546 7:43433642-43433664 CTGTTGCTGCTCAGTTGAAAAGG + Intronic
1026141042 7:67707043-67707065 TTGAGACTGGACAGTTGAGATGG - Intergenic
1026879044 7:73896973-73896995 CTGGGACATCTCAGTGGAGAAGG - Intergenic
1027237592 7:76307313-76307335 TTTCGACTGCTCTGTTGAGAGGG + Intergenic
1028285222 7:88988571-88988593 CTGCAACTGCTCTTTTGAGAAGG + Intronic
1028832253 7:95340882-95340904 CTGTGACAGCTCAGCACAGAGGG - Intergenic
1029957780 7:104657767-104657789 CTATGACTTCTGAGTTGGGAAGG - Intronic
1030524847 7:110640567-110640589 CGTTGCCTGCTCAGTTGAGTAGG + Intergenic
1031350913 7:120729757-120729779 CTGTGTTTTCTCAGTTGTGAAGG + Intronic
1034971179 7:155420259-155420281 CTGAGCCTGCTCAGTTGTGCTGG - Intergenic
1034990783 7:155546882-155546904 CTGTGGCTGCCCAGTGGAGGCGG + Intergenic
1035683126 8:1503388-1503410 TTGTGACTGCTCATTTCACATGG + Intronic
1036717736 8:11142138-11142160 CTGTGCCTTCCCAGTAGAGAGGG - Intronic
1038671905 8:29589613-29589635 CTGTGACTGCCAGGTTCAGAGGG + Intergenic
1039576424 8:38627434-38627456 CTGTCACTCCCCATTTGAGAAGG - Intergenic
1039918918 8:41879485-41879507 CAGTGTCTGTTCTGTTGAGAGGG - Intronic
1040578807 8:48678137-48678159 CTGTGACTGCTCTGCTGAGAAGG - Intergenic
1040802545 8:51358905-51358927 CTCTGAGTCCTCAGTTGAGCAGG - Intronic
1041699211 8:60769226-60769248 CTGAAACAGCTCAGTTCAGAGGG + Intronic
1042747325 8:72121590-72121612 CTGAGACTCCTCTGTGGAGATGG - Intergenic
1047215241 8:122870783-122870805 CTGTGACTGCTCAGTTGAGAGGG - Intronic
1047499774 8:125431802-125431824 CTGGGACTGCTCCCTTGGGAGGG - Intronic
1049037500 8:140087764-140087786 CTGTGACTGCTGGTTGGAGATGG - Intronic
1049549746 8:143251640-143251662 CTGAGACTGCTCAATGGACAAGG - Intronic
1049883288 9:12448-12470 CTGTGACTGCTCAGACCAGCCGG + Intergenic
1057254511 9:93534193-93534215 CTGTTAATGCACAGTAGAGAAGG + Intronic
1057443867 9:95100029-95100051 CTGTGACTCCTCTGTGGACATGG - Exonic
1057804764 9:98212162-98212184 CTGTGACTGCTCAGGAGGGTGGG - Intronic
1058526018 9:105858457-105858479 CTATGACTGCAGAGTGGAGAAGG - Intergenic
1059086125 9:111304838-111304860 CTGTGTCTGCTAAGTTGAGTTGG - Intergenic
1059155283 9:111983841-111983863 CTGTGGCTGCTCAGAAGGGAAGG - Intergenic
1059377441 9:113895641-113895663 CTGAGATTGCTGTGTTGAGAAGG + Intronic
1059426406 9:114223441-114223463 CTGTGCCTGCTCAGGTGAGTGGG + Intronic
1060526639 9:124324670-124324692 CTGGGACGGCTCACCTGAGAGGG + Intronic
1061590229 9:131593305-131593327 CAGAGACAGCACAGTTGAGAAGG - Intronic
1186446570 X:9635090-9635112 CTGTGGCTGCTGAGTTGGTATGG + Intronic
1187581994 X:20616990-20617012 CTGAGACTGCTCAGTATGGATGG + Intergenic
1188933829 X:36148690-36148712 CTCTGGCTGCTCAGTGTAGAAGG - Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1190726607 X:53194256-53194278 ATGTGACTGCTCTTTTGGGACGG - Exonic
1200402525 X:156027700-156027722 CTGTGACTGCTCAGACCAGCCGG - Intergenic
1200758690 Y:7016151-7016173 CTGTGGCTGCTGAGTTGGTATGG + Intronic
1200818472 Y:7557526-7557548 CTGTACCTGCTCAGCAGAGAAGG - Intergenic