ID: 1047215242

View in Genome Browser
Species Human (GRCh38)
Location 8:122870784-122870806
Sequence GCTGTGACTGCTCAGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215242_1047215248 28 Left 1047215242 8:122870784-122870806 CCTCTCAACTGAGCAGTCACAGC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1047215248 8:122870835-122870857 GCACCAATTCAGAGAAAGAATGG No data
1047215242_1047215244 -10 Left 1047215242 8:122870784-122870806 CCTCTCAACTGAGCAGTCACAGC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215242_1047215245 -9 Left 1047215242 8:122870784-122870806 CCTCTCAACTGAGCAGTCACAGC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1047215245 8:122870798-122870820 AGTCACAGCAGAAATGGAGTGGG No data
1047215242_1047215246 -8 Left 1047215242 8:122870784-122870806 CCTCTCAACTGAGCAGTCACAGC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1047215246 8:122870799-122870821 GTCACAGCAGAAATGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215242 Original CRISPR GCTGTGACTGCTCAGTTGAG AGG (reversed) Intronic
905188651 1:36215645-36215667 GCTCTGACTGCAGAGTAGAGTGG - Intergenic
907779238 1:57550459-57550481 GGTGTGAATACTCAGTAGAGGGG - Intronic
909714869 1:78695503-78695525 GCTGAGATAGCTCAGTTGGGAGG - Intergenic
915074556 1:153297764-153297786 GCTGTGAATGCCCAGCTGTGAGG + Intergenic
916572073 1:166036775-166036797 TCTGTGTCTGCTGCGTTGAGGGG - Intergenic
920580336 1:207100905-207100927 GCTATGAGAGCTCAGATGAGAGG + Intergenic
921322173 1:213952686-213952708 GCTGTGACTGCCCAGGTCTGTGG - Intergenic
924785951 1:247199845-247199867 GATGTGCGTGCTCAGATGAGTGG - Intergenic
1067826066 10:49573957-49573979 ACTGTGGCTGGTCAGATGAGGGG + Intergenic
1069789027 10:71007601-71007623 GCTGTGCCTGCTCAGAGAAGAGG + Intergenic
1072194890 10:93109041-93109063 GCTGTGTCTCCTCGATTGAGGGG + Intergenic
1072687980 10:97550021-97550043 GCTGTGACTGCTGGGGTGGGAGG + Intronic
1073913858 10:108378798-108378820 GATCTGGCTGCTGAGTTGAGGGG + Intergenic
1077088215 11:765307-765329 GCTGGGACTGCTCCTCTGAGAGG - Intergenic
1077182825 11:1224153-1224175 GCCCTGCCTGCTCAGGTGAGGGG - Intronic
1077893897 11:6439722-6439744 GCTGTGTCTGCTCAGAGGAAGGG - Intronic
1081709543 11:45208055-45208077 CCTCTGGCTGCTCAGTTGAGAGG + Intronic
1084335494 11:68455356-68455378 GCTGTCACTGCAGAGGTGAGAGG - Intergenic
1084620337 11:70265616-70265638 GCTGTGACAACACAGTTCAGGGG - Intergenic
1088371544 11:109093998-109094020 GCTATGACTTACCAGTTGAGAGG + Intergenic
1091149997 11:133319329-133319351 GCTGTGTGTGGTCAGTTCAGAGG - Intronic
1096662096 12:53132148-53132170 GCTGTCACTTCACAGTTAAGTGG - Intergenic
1099474249 12:83088624-83088646 GCTCTGACTGCTCAATAGACTGG - Intronic
1102626686 12:114240604-114240626 GCTGTGACAACTCTGGTGAGAGG - Intergenic
1103270963 12:119673441-119673463 CCTGTGACTGCTGTGCTGAGTGG - Intronic
1109923647 13:69104834-69104856 GGTATGAGTGTTCAGTTGAGTGG - Intergenic
1111172603 13:84547776-84547798 TCTTTGACTGCACAGTTGACTGG + Intergenic
1111673165 13:91354125-91354147 ACCTTTACTGCTCAGTTGAGAGG - Intergenic
1113098779 13:106694910-106694932 GATGTGGCTGGACAGTTGAGAGG - Intergenic
1113357909 13:109600933-109600955 GCTGGATATGCTCAGTTGAGAGG - Intergenic
1117503867 14:56381328-56381350 GCTGTGTCTTCCCAGTTGATAGG - Intergenic
1118176714 14:63447915-63447937 GTTGTGACTGCTCTGCTGAGCGG - Intronic
1119218848 14:72890778-72890800 GATGTGACTGCTTGGTTGTGGGG + Intronic
1119739456 14:77004824-77004846 CAGGTGTCTGCTCAGTTGAGGGG + Intergenic
1122854854 14:104555091-104555113 GCTGTGACTCCTCTGTGCAGGGG + Intronic
1125349101 15:38748991-38749013 GCTGGGCCTGCTTAATTGAGAGG + Intergenic
1127833307 15:62769687-62769709 CCAGTGACTGCTCATGTGAGTGG + Intronic
1132720887 16:1315102-1315124 GCTGGGACTGCTCAGCTCAGGGG - Intronic
1134801536 16:17089397-17089419 GATGTGACTGCACAGCTGACTGG - Intergenic
1135788199 16:25369207-25369229 AGTGTGACTGCTTGGTTGAGTGG + Intergenic
1138131587 16:54484519-54484541 TGTGTCACTGCTCAGGTGAGGGG + Intergenic
1139628245 16:68209387-68209409 CCTGCCACTGCTGAGTTGAGTGG + Intronic
1140833355 16:78771226-78771248 GCTCTGGCTGCTGTGTTGAGTGG + Intronic
1141462024 16:84183402-84183424 GATGTGACTGAGCAGGTGAGTGG - Exonic
1143516076 17:7419862-7419884 GTTGTGCCTGCTCTGTTGTGGGG + Intergenic
1143828883 17:9635244-9635266 GGTGTGAATGCTAAGTTGAAGGG - Intronic
1144826724 17:18109302-18109324 GCAGTGAGGGCTCAGGTGAGAGG + Intronic
1145290031 17:21535618-21535640 GTTGTGACTACTGACTTGAGTGG + Intronic
1146658856 17:34651446-34651468 GCTGGGACTGCGCAGTGGCGTGG + Intergenic
1149516449 17:57284482-57284504 GCTGTGACTGCACAGCTGTAGGG - Intronic
1151698354 17:75729647-75729669 GCTGTGACTGCTCAGGCCAGGGG - Intronic
1153774647 18:8441874-8441896 GTTGTAACTGCTCTGTAGAGAGG + Intergenic
1155063491 18:22248806-22248828 GCTGTGTCTGATCTTTTGAGGGG + Intergenic
1158845134 18:61434048-61434070 GCTGTTACTGCTCAGATTTGGGG - Intronic
1162517044 19:11154870-11154892 TCTGTAACTGCACAGTTCAGTGG - Intronic
1163834942 19:19567549-19567571 GCTGTGCCTGCCCAGGTGGGAGG + Intronic
1167248587 19:48389519-48389541 GCTGTGACTCCTTATTTGGGGGG - Intronic
928910180 2:36412499-36412521 TCTGTCACTGTTCAGTTCAGAGG + Intronic
932143112 2:69296967-69296989 GCTGTGGGTGCTCAGAGGAGGGG - Intergenic
937037819 2:118796352-118796374 TCACTGACTGCTGAGTTGAGAGG + Intergenic
937292814 2:120792033-120792055 GCTGTGACTGCTGAGAGGCGAGG + Intronic
938780804 2:134583122-134583144 GCTGTGACTGCTGTGCTGAGAGG - Intronic
943101556 2:183493008-183493030 GATCTGAGTGCTCAGTGGAGGGG + Intergenic
943701253 2:190990224-190990246 GCTCTGTCTGCTCCGTTCAGTGG + Intronic
946345313 2:219105053-219105075 GCTGTCACTGCTTGATTGAGAGG + Intronic
948657007 2:239482591-239482613 TCTGTGACTTCTCAATTTAGGGG + Intergenic
1168731966 20:92328-92350 AGTGTGACTACTCATTTGAGGGG - Intronic
1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG + Intronic
1174143621 20:48434853-48434875 TCTGTGACTGCACAGGTGTGGGG + Intergenic
1175082375 20:56431614-56431636 GCTGTGAGTGCCCAGTGGGGTGG + Intronic
1184556010 22:45233474-45233496 GCTGTGGCTGCTGTGCTGAGGGG - Intronic
1184837480 22:47032431-47032453 CCTGTGAGTGCTTGGTTGAGAGG + Intronic
1185292349 22:50033459-50033481 GCTGTGCATGCTGGGTTGAGCGG - Intronic
950096558 3:10334102-10334124 GCTGTGAAAGCTAAGATGAGGGG + Intronic
950097171 3:10337098-10337120 GCTGTGCCAGCTCAGTAGAAGGG + Intronic
950292346 3:11795480-11795502 GCTGTAACTCCTCAGCTGACTGG + Intronic
950528190 3:13536824-13536846 GCTGTGGCTGCACAGTCCAGGGG + Intergenic
950856585 3:16111445-16111467 GCTCTGACTGGTCACTGGAGTGG + Intergenic
953584240 3:44185420-44185442 GGTGTGACTGCGCAGGTGAAAGG - Intergenic
955233225 3:57117678-57117700 CCTGTTACTGCTCAGTTGACTGG - Intronic
955332391 3:58058076-58058098 ACTGTGCCTGGCCAGTTGAGTGG + Intronic
956777499 3:72577677-72577699 CCTGTGACTGCTGTGTGGAGAGG - Intergenic
957838340 3:85630832-85630854 TCTCTGACTGCTCTGTGGAGAGG - Intronic
959086477 3:101855741-101855763 GCTATGACTGCACAGTGAAGGGG - Exonic
960242572 3:115362770-115362792 ACAGTGACTCCTGAGTTGAGAGG + Intergenic
961595162 3:128010065-128010087 GCTGTCTCTCCTCAGTGGAGGGG - Intergenic
964870391 3:161307506-161307528 GCTCTGACTGCTCCATTGACTGG + Intergenic
965182622 3:165424165-165424187 ACTCTGACAGCTCAGTGGAGAGG - Intergenic
965841363 3:172909345-172909367 CCTGTGACTGCTTTGATGAGTGG + Intronic
966084772 3:176056785-176056807 ACAGTGACTTCTCAGTTGAAGGG + Intergenic
968750111 4:2384440-2384462 GCTGTGACTGACCACTGGAGGGG + Intronic
974859317 4:67499966-67499988 GCTCTGACTGCTCTGCTGACTGG - Intronic
975133745 4:70853784-70853806 GTTCTGACTGCTCCGTTGAGTGG + Intergenic
976376476 4:84351373-84351395 GCAGTGATTTCTCAGTTAAGTGG + Intergenic
976973816 4:91141648-91141670 AATGTGACTGCTGGGTTGAGTGG + Intronic
982707153 4:158723092-158723114 CCGGTGACTGCTCAGTTTCGCGG - Intronic
990058317 5:51614004-51614026 GCACTGGCTGCTAAGTTGAGAGG + Intergenic
993342185 5:86738478-86738500 GCAGTGACTCCACTGTTGAGGGG + Intergenic
994507355 5:100658952-100658974 GCTGCCACTGCACAGTTGAAAGG + Intergenic
997272935 5:132557007-132557029 GCTGTGAGTGCGCGGTTGCGGGG + Exonic
997859799 5:137406044-137406066 GCTGTGACAGTCCAGCTGAGAGG + Intronic
999098524 5:149003374-149003396 GTTGTGACTGCCCTGTGGAGAGG + Intronic
999420398 5:151436952-151436974 CCTGGGAGTGCTCAGATGAGAGG - Intergenic
1000281240 5:159784180-159784202 GCTGTGACTGCCTTATTGAGGGG + Intergenic
1002398493 5:178976501-178976523 CCTGGGACTGCTCAGCTGTGGGG + Intergenic
1003580133 6:7332537-7332559 GCTGTGGCTGCTCAGCAGAGGGG - Intronic
1018449349 6:163892583-163892605 CCTGTGACTGCCCAGCAGAGGGG + Intergenic
1018952143 6:168386152-168386174 GGTGTGCCTGCTCAGGTGTGGGG + Intergenic
1020377011 7:7499304-7499326 GTTGTGACTGCTCAGTGTATAGG - Intronic
1023975428 7:45026098-45026120 GGTGAGGCTGCTCAGCTGAGTGG + Intronic
1031183695 7:118448752-118448774 GTTCTGACTGCTCAATTGACTGG - Intergenic
1032477049 7:132218683-132218705 GCTGCTCCTGCTCAGTAGAGGGG + Intronic
1036668602 8:10764802-10764824 GCTGCCACTGCTTAGTGGAGGGG + Intronic
1037875940 8:22548492-22548514 GGTCTGACTGCTCAGCTTAGAGG + Intronic
1039638615 8:39194226-39194248 GCAGTGGCTGCTCAGTGAAGGGG + Intronic
1039918919 8:41879486-41879508 GCAGTGTCTGTTCTGTTGAGAGG - Intronic
1044370836 8:91409016-91409038 GCTGCATCTGCTAAGTTGAGAGG - Intergenic
1046660286 8:116941212-116941234 GCTGTGGATGCACAGATGAGAGG + Intronic
1047215242 8:122870784-122870806 GCTGTGACTGCTCAGTTGAGAGG - Intronic
1047572423 8:126114033-126114055 CCTGTGACTGCCCATTTGTGTGG - Intergenic
1050836196 9:10081888-10081910 GCTGTAAATGATCAGATGAGAGG - Intronic
1057009320 9:91587742-91587764 GCTGTGACTTCTTAGTCGGGTGG + Intronic
1057804765 9:98212163-98212185 GCTGTGACTGCTCAGGAGGGTGG - Intronic
1059426405 9:114223440-114223462 TCTGTGCCTGCTCAGGTGAGTGG + Intronic
1059671840 9:116499481-116499503 GCTGTGGGAACTCAGTTGAGGGG - Intronic
1060755411 9:126208724-126208746 GGAGTGACTGCTCAGTGGACTGG + Intergenic
1060818861 9:126650367-126650389 GCTCTGACCGGTCAGCTGAGAGG + Intronic
1189300686 X:39950074-39950096 GCTGGGACTGCTAAGCTGGGAGG - Intergenic
1190065590 X:47239718-47239740 GCTGTGACCTCTCAAATGAGAGG - Intronic
1198527489 X:137516529-137516551 GTTGTGACTGATATGTTGAGTGG + Intergenic
1199377325 X:147128926-147128948 GATGGGACTGCTGAGTTGAATGG + Intergenic
1200272858 X:154703122-154703144 GATGGGACTGCTGGGTTGAGTGG - Intronic
1201901199 Y:19047122-19047144 GCTGTCACCTCTCAGTTGGGTGG + Intergenic