ID: 1047215244

View in Genome Browser
Species Human (GRCh38)
Location 8:122870797-122870819
Sequence CAGTCACAGCAGAAATGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047215237_1047215244 17 Left 1047215237 8:122870757-122870779 CCGATGGCCCCAGAGAGAAGGAG 0: 1
1: 0
2: 3
3: 25
4: 280
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215242_1047215244 -10 Left 1047215242 8:122870784-122870806 CCTCTCAACTGAGCAGTCACAGC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215241_1047215244 -9 Left 1047215241 8:122870783-122870805 CCCTCTCAACTGAGCAGTCACAG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215239_1047215244 9 Left 1047215239 8:122870765-122870787 CCCAGAGAGAAGGAGTGACCCTC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215240_1047215244 8 Left 1047215240 8:122870766-122870788 CCAGAGAGAAGGAGTGACCCTCT 0: 1
1: 0
2: 2
3: 30
4: 424
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data
1047215238_1047215244 10 Left 1047215238 8:122870764-122870786 CCCCAGAGAGAAGGAGTGACCCT 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047215244 Original CRISPR CAGTCACAGCAGAAATGGAG TGG Intronic
No off target data available for this crispr