ID: 1047219863

View in Genome Browser
Species Human (GRCh38)
Location 8:122910717-122910739
Sequence CAGTGTGCAGGCCCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047219849_1047219863 18 Left 1047219849 8:122910676-122910698 CCTCACCCTGGAGGCTTGCCCAA 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data
1047219852_1047219863 0 Left 1047219852 8:122910694-122910716 CCCAATCGAGACCCTTCCCCAGC 0: 1
1: 0
2: 0
3: 3
4: 119
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data
1047219847_1047219863 23 Left 1047219847 8:122910671-122910693 CCAACCCTCACCCTGGAGGCTTG 0: 1
1: 0
2: 0
3: 21
4: 302
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data
1047219850_1047219863 13 Left 1047219850 8:122910681-122910703 CCCTGGAGGCTTGCCCAATCGAG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data
1047219848_1047219863 19 Left 1047219848 8:122910675-122910697 CCCTCACCCTGGAGGCTTGCCCA 0: 1
1: 0
2: 2
3: 15
4: 206
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data
1047219851_1047219863 12 Left 1047219851 8:122910682-122910704 CCTGGAGGCTTGCCCAATCGAGA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data
1047219853_1047219863 -1 Left 1047219853 8:122910695-122910717 CCAATCGAGACCCTTCCCCAGCC 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047219863 Original CRISPR CAGTGTGCAGGCCCCTGCTG GGG Intronic
No off target data available for this crispr