ID: 1047224846

View in Genome Browser
Species Human (GRCh38)
Location 8:122947686-122947708
Sequence AAAGTCAGCCTCCCACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047224846_1047224854 15 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224854 8:122947724-122947746 AAACCAGGCGGTTCTCGGGGTGG No data
1047224846_1047224851 10 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224851 8:122947719-122947741 CCTAAAAACCAGGCGGTTCTCGG No data
1047224846_1047224853 12 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224853 8:122947721-122947743 TAAAAACCAGGCGGTTCTCGGGG No data
1047224846_1047224855 16 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224855 8:122947725-122947747 AACCAGGCGGTTCTCGGGGTGGG No data
1047224846_1047224848 0 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224848 8:122947709-122947731 TCAATGGAGACCTAAAAACCAGG No data
1047224846_1047224849 3 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224849 8:122947712-122947734 ATGGAGACCTAAAAACCAGGCGG No data
1047224846_1047224852 11 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224852 8:122947720-122947742 CTAAAAACCAGGCGGTTCTCGGG No data
1047224846_1047224857 25 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT No data
Right 1047224857 8:122947734-122947756 GTTCTCGGGGTGGGATGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047224846 Original CRISPR AAAGTCAGCCTCCCACAGAG AGG (reversed) Intronic