ID: 1047224854

View in Genome Browser
Species Human (GRCh38)
Location 8:122947724-122947746
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047224846_1047224854 15 Left 1047224846 8:122947686-122947708 CCTCTCTGTGGGAGGCTGACTTT 0: 1
1: 0
2: 1
3: 14
4: 215
Right 1047224854 8:122947724-122947746 AAACCAGGCGGTTCTCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr