ID: 1047229420

View in Genome Browser
Species Human (GRCh38)
Location 8:122983611-122983633
Sequence ACCCCGTATTCACCTTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047229420_1047229422 29 Left 1047229420 8:122983611-122983633 CCAAATAAAGGTGAATACGGGGT No data
Right 1047229422 8:122983663-122983685 ATATATTCCAACTGGCTCTCAGG No data
1047229420_1047229423 30 Left 1047229420 8:122983611-122983633 CCAAATAAAGGTGAATACGGGGT No data
Right 1047229423 8:122983664-122983686 TATATTCCAACTGGCTCTCAGGG No data
1047229420_1047229421 21 Left 1047229420 8:122983611-122983633 CCAAATAAAGGTGAATACGGGGT No data
Right 1047229421 8:122983655-122983677 AAAGACATATATATTCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047229420 Original CRISPR ACCCCGTATTCACCTTTATT TGG (reversed) Intergenic