ID: 1047229420 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:122983611-122983633 |
| Sequence | ACCCCGTATTCACCTTTATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047229420_1047229422 | 29 | Left | 1047229420 | 8:122983611-122983633 | CCAAATAAAGGTGAATACGGGGT | No data | ||
| Right | 1047229422 | 8:122983663-122983685 | ATATATTCCAACTGGCTCTCAGG | No data | ||||
| 1047229420_1047229423 | 30 | Left | 1047229420 | 8:122983611-122983633 | CCAAATAAAGGTGAATACGGGGT | No data | ||
| Right | 1047229423 | 8:122983664-122983686 | TATATTCCAACTGGCTCTCAGGG | No data | ||||
| 1047229420_1047229421 | 21 | Left | 1047229420 | 8:122983611-122983633 | CCAAATAAAGGTGAATACGGGGT | No data | ||
| Right | 1047229421 | 8:122983655-122983677 | AAAGACATATATATTCCAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047229420 | Original CRISPR | ACCCCGTATTCACCTTTATT TGG (reversed) | Intergenic | ||