ID: 1047232513

View in Genome Browser
Species Human (GRCh38)
Location 8:123009465-123009487
Sequence TGGCCGTGATGACATGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047232509_1047232513 -9 Left 1047232509 8:123009451-123009473 CCTGTGGGTCTCTCTGGCCGTGA No data
Right 1047232513 8:123009465-123009487 TGGCCGTGATGACATGGCAGGGG No data
1047232504_1047232513 12 Left 1047232504 8:123009430-123009452 CCTAGATTTAATTCTGTACTCCC No data
Right 1047232513 8:123009465-123009487 TGGCCGTGATGACATGGCAGGGG No data
1047232503_1047232513 19 Left 1047232503 8:123009423-123009445 CCTTGCACCTAGATTTAATTCTG No data
Right 1047232513 8:123009465-123009487 TGGCCGTGATGACATGGCAGGGG No data
1047232508_1047232513 -8 Left 1047232508 8:123009450-123009472 CCCTGTGGGTCTCTCTGGCCGTG No data
Right 1047232513 8:123009465-123009487 TGGCCGTGATGACATGGCAGGGG No data
1047232502_1047232513 26 Left 1047232502 8:123009416-123009438 CCTTACGCCTTGCACCTAGATTT No data
Right 1047232513 8:123009465-123009487 TGGCCGTGATGACATGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047232513 Original CRISPR TGGCCGTGATGACATGGCAG GGG Intergenic