ID: 1047233510

View in Genome Browser
Species Human (GRCh38)
Location 8:123018262-123018284
Sequence CACCCAGATGGTGATTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047233505_1047233510 18 Left 1047233505 8:123018221-123018243 CCCTGATATGAGATTAGGCATGA 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1047233510 8:123018262-123018284 CACCCAGATGGTGATTTAACTGG 0: 1
1: 0
2: 0
3: 7
4: 109
1047233506_1047233510 17 Left 1047233506 8:123018222-123018244 CCTGATATGAGATTAGGCATGAT 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1047233510 8:123018262-123018284 CACCCAGATGGTGATTTAACTGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047233510 Original CRISPR CACCCAGATGGTGATTTAAC TGG Intronic
903572732 1:24318449-24318471 CAGCCAGCTGGTCATTTCACAGG - Intergenic
906059885 1:42941656-42941678 CCCCCAGATTCTGATTTAATTGG - Intronic
909444847 1:75737650-75737672 CAGCCAGATGGTCTTTTGACAGG - Intronic
912830566 1:112949512-112949534 CACACAGATGCTGATGTCACAGG - Intronic
915666270 1:157448066-157448088 CACTCAAAGGTTGATTTAACTGG - Intergenic
916094361 1:161335659-161335681 CACCCAGATACTGATTTCACAGG - Intronic
917165544 1:172108388-172108410 CAGCAAGATTGTGATTTAATTGG + Intronic
922127205 1:222739489-222739511 CACAGAGATTGTGATTTAAGTGG + Intronic
924476297 1:244384578-244384600 CACGGAGATCCTGATTTAACTGG - Intronic
1064741724 10:18441105-18441127 CAGCCGGATGGTTATTAAACTGG - Intronic
1066622700 10:37374933-37374955 CACCCAGAAGTTGATATTACAGG + Intronic
1068876522 10:62002613-62002635 CAACCAGTTGGAGATTTAAAAGG - Intronic
1070313913 10:75293619-75293641 CACACAGATGGTGAGTGGACGGG - Intergenic
1070530787 10:77335504-77335526 CTCCCAGATTCTGATTTAATTGG + Intronic
1072527696 10:96288368-96288390 CACCCTGATACTGATTTATCGGG - Intergenic
1074160447 10:110832628-110832650 CACACAGATGGTGAGTTATTGGG + Intronic
1075059652 10:119246915-119246937 CAGCCAGCTGCTGTTTTAACTGG + Intronic
1077541515 11:3148694-3148716 TACCCAGATGGAGTTTTAAGAGG + Intronic
1078111108 11:8393350-8393372 CAAGCAGATGGAGTTTTAACAGG + Intronic
1087292702 11:96337938-96337960 AACCCAGATGGTGATCCAGCAGG + Intronic
1092700759 12:11228345-11228367 CACACAAATGGTGAAGTAACAGG - Intergenic
1095943914 12:47743286-47743308 CACACAGATGGTGAGCTAAAGGG + Intronic
1098033246 12:66276243-66276265 CACCGAGGTGCTGATTTATCAGG + Intergenic
1099964776 12:89433910-89433932 CACCCAGATGGGGCTGTCACAGG + Intronic
1101184875 12:102265328-102265350 CACCCAGATGTGGAGTGAACTGG + Intergenic
1101366746 12:104078916-104078938 CACCCAGATGGTAGTTTTATGGG + Intronic
1101469252 12:104981280-104981302 CACCAAGATGATGATGTAAGAGG + Intergenic
1103139577 12:118536700-118536722 CACCCAGCTGGTCACTTTACTGG - Intergenic
1103435037 12:120918675-120918697 CTCCCAGCTGCTGATTTTACTGG + Intergenic
1104404712 12:128507915-128507937 CACTCAGATGGAGCTCTAACCGG + Intronic
1116176164 14:41473160-41473182 CACCCAGATGGTGTTTCAGTAGG + Intergenic
1116309065 14:43298261-43298283 CATTCAGATGGTAATTTAACTGG - Intergenic
1117937410 14:60922040-60922062 TACCAAAAGGGTGATTTAACTGG - Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1123687777 15:22811699-22811721 CACCCAGATGGAGCTTAAAGAGG - Intronic
1124131051 15:26985985-26986007 CACCTAGATGGTGAGTCATCAGG - Intronic
1130954115 15:88614814-88614836 CCCCAAGATTCTGATTTAACTGG - Intergenic
1130995141 15:88899308-88899330 CAGCCCTATGGTGATTTAAAGGG + Exonic
1134502006 16:14776688-14776710 CAACCAGTTGGTGATTGAGCTGG + Intronic
1134578555 16:15352205-15352227 CAACCAGTTGGTGATTGAGCTGG - Intergenic
1134724033 16:16405339-16405361 CAACCAGTTGGTGATTGAGCTGG + Intergenic
1134943397 16:18306530-18306552 CAACCAGTTGGTGATTGAGCTGG - Intergenic
1137359419 16:47799498-47799520 CACCCACACTGTGATTTAAGGGG - Intergenic
1140617374 16:76682701-76682723 CACCCTGGTGGTGTTTTACCAGG - Intergenic
1141336694 16:83162726-83162748 CACACAGATTGTGATTCAATAGG + Intronic
1146087351 17:29842115-29842137 CACAGAGATCCTGATTTAACTGG + Intronic
1146535424 17:33646729-33646751 CACCCAGAAGTTGATATTACAGG - Intronic
1152507671 17:80761847-80761869 CTCCCAGAGGGTGAAGTAACCGG + Intronic
1203165950 17_GL000205v2_random:95649-95671 ACCCCAGATGCTGATCTAACTGG + Intergenic
1155068694 18:22293133-22293155 CCCCCAGTTGTAGATTTAACAGG - Intergenic
1155731491 18:29165195-29165217 CACCTAGATGGTGGCTTGACAGG - Intergenic
1157564142 18:48668386-48668408 CACGCAGTTGGTGCTTTCACAGG + Intronic
1158321245 18:56267104-56267126 CACCCAGATGGTGGCTGAAGAGG - Intergenic
1158886693 18:61834905-61834927 CCCCCAGACGCTGATTTATCAGG - Intronic
1160943220 19:1629679-1629701 CAGCCAGAAGGGGATTTAAGTGG - Intronic
1162435508 19:10655390-10655412 CATCCAGGCGGTGAATTAACTGG - Intronic
927305489 2:21567002-21567024 AACCCAGATGATGATTTGATAGG + Intergenic
928644094 2:33333703-33333725 CACCCACATGGATATTTCACAGG - Intronic
929261982 2:39876041-39876063 CAGCAAGATGGTGGTTTGACAGG + Intergenic
930584834 2:53256746-53256768 CACCAAGGTTCTGATTTAACTGG + Intergenic
942525946 2:176852992-176853014 CACTAGGATGGTGATTTAAAGGG + Intergenic
943666487 2:190614860-190614882 CACTCAAAGGGTGAGTTAACTGG - Intergenic
947166685 2:227269099-227269121 CACCCAGAAGGTCATTTAAAGGG + Intronic
947398345 2:229708332-229708354 CCCCCAGATTCTGATTTAATTGG - Intronic
948659667 2:239499216-239499238 CACCCAGCTGGAGATGTAAGGGG - Intergenic
1168964008 20:1887987-1888009 TACTGAGATGGTGAATTAACTGG + Intergenic
1172173282 20:32957434-32957456 CATCCAGTTGGGGATTGAACTGG + Intronic
1174205856 20:48838201-48838223 AACCCACATGGTGACTTCACAGG + Intergenic
1175190055 20:57205609-57205631 AACCCAGATGGTGATTTTGCTGG + Intronic
1176405803 21:6363447-6363469 ACCCCAGATGCTGATCTAACTGG - Intergenic
1177303652 21:19284230-19284252 CATCCAGATGGTATTTTATCTGG - Intergenic
1177306336 21:19321581-19321603 CACTCAAGTGGTGATTTAATTGG + Intergenic
1179020558 21:37636714-37636736 CTGCAAGATGGAGATTTAACAGG + Intronic
1179208787 21:39308645-39308667 CACAAAGATTCTGATTTAACTGG + Intronic
1181105531 22:20572575-20572597 CACCCACAAGGGGATTTAGCAGG + Intronic
1184634679 22:45817721-45817743 CACACAGAAGGTGATTTCACAGG + Intronic
1185302833 22:50091512-50091534 CTCCCAGATGCTGATATAAGTGG + Intronic
950607438 3:14095532-14095554 CACCCAGATTGTTATTAACCTGG - Intergenic
952100405 3:30005413-30005435 AACCAAGATGCTTATTTAACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
964509085 3:157430620-157430642 AACACAGATGTTGATTCAACAGG + Intronic
965405632 3:168264720-168264742 CACCAAGACGGTCATTTTACAGG + Intergenic
976815315 4:89140648-89140670 CACCAAGATCGTGCTTTAACAGG + Intergenic
978195438 4:105966717-105966739 AAAGCAGATGGTGATTTAAAGGG - Intronic
978338552 4:107696644-107696666 AACCCAGATGATGGGTTAACAGG + Intronic
982524388 4:156459057-156459079 CACCAAGCTGATGATGTAACTGG - Intergenic
982901030 4:161003277-161003299 CACTCAGATGGTGCTTTTTCCGG - Intergenic
984285485 4:177723325-177723347 CCACCAGAAGCTGATTTAACTGG + Intergenic
984503094 4:180581013-180581035 CACCAAGATTCTGATTTAATTGG + Intergenic
989704075 5:44306793-44306815 CATTCAAATGATGATTTAACTGG + Intronic
994150637 5:96443674-96443696 CCCACAGATTGTGATTTAATTGG + Intergenic
994255726 5:97593637-97593659 CACCCAGATGGAGATGTATAAGG - Intergenic
994294935 5:98079949-98079971 CAGCATGATGGTGATTTGACTGG + Intergenic
1002261482 5:177996459-177996481 CTCCCAGGAGGGGATTTAACAGG - Intergenic
1004672801 6:17813795-17813817 TACCCAGATGGTCAGTTAGCTGG - Intronic
1008670800 6:53766678-53766700 CACTGAGATCGTGATATAACTGG + Intergenic
1017586763 6:155935367-155935389 CACCCATATTGTGATTTAGTTGG - Intergenic
1022412821 7:30152482-30152504 AACGCAGATGATGATTCAACAGG - Intronic
1024246389 7:47473273-47473295 CACCTGGATGCTGATCTAACAGG + Intronic
1024996504 7:55276620-55276642 CACGAAGATTATGATTTAACTGG + Intergenic
1026209175 7:68288113-68288135 CATCCAGATGGCGATTGAAGGGG + Intergenic
1028193737 7:87880754-87880776 CACCCAGATTCTGATATAAAGGG + Intronic
1031351041 7:120731414-120731436 CCCCCAGATGGTGATTATTCAGG - Intronic
1047233510 8:123018262-123018284 CACCCAGATGGTGATTTAACTGG + Intronic
1051907261 9:22109754-22109776 TACCCAAATAGTGATTTATCAGG + Intergenic
1053064074 9:35054746-35054768 CACCCAGATAATGCTTTACCAGG - Intergenic
1059484240 9:114614700-114614722 CACCAAGATGGTTAGTTAGCAGG + Intronic
1186247277 X:7627559-7627581 CACCTAGATGGTGACTTCAATGG + Intergenic
1186765978 X:12771112-12771134 CCCAGAGATTGTGATTTAACTGG - Intergenic
1187476372 X:19614554-19614576 CCCCCAAATTGTGATTTAATGGG - Intronic
1188991944 X:36831776-36831798 CACCCAGCTGGTGATTTTGGGGG - Intergenic
1192612083 X:72576812-72576834 CACCCATATGGTTCTTAAACTGG + Intergenic
1195882087 X:109603163-109603185 CACACAGATGATGATAAAACTGG + Intergenic
1197264909 X:124358822-124358844 AATCCAGATTCTGATTTAACAGG + Intronic
1198368905 X:135972736-135972758 AACCCAGATTCTGATTGAACAGG + Intronic
1198500426 X:137239312-137239334 CACCCAGTTGCTGATTTATCGGG + Intergenic
1199168548 X:144707446-144707468 CACACAGAGGGTGTTTTAAAAGG - Intergenic