ID: 1047234325

View in Genome Browser
Species Human (GRCh38)
Location 8:123026097-123026119
Sequence AAACCCAACAAGTGTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047234319_1047234325 30 Left 1047234319 8:123026044-123026066 CCGTTCCACACCCCCTCACAGTT 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG No data
1047234324_1047234325 17 Left 1047234324 8:123026057-123026079 CCTCACAGTTACATGATACAGCT 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG No data
1047234322_1047234325 19 Left 1047234322 8:123026055-123026077 CCCCTCACAGTTACATGATACAG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG No data
1047234321_1047234325 20 Left 1047234321 8:123026054-123026076 CCCCCTCACAGTTACATGATACA 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG No data
1047234320_1047234325 25 Left 1047234320 8:123026049-123026071 CCACACCCCCTCACAGTTACATG 0: 1
1: 0
2: 1
3: 19
4: 241
Right 1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG No data
1047234323_1047234325 18 Left 1047234323 8:123026056-123026078 CCCTCACAGTTACATGATACAGC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047234325 Original CRISPR AAACCCAACAAGTGTCAGTA AGG Intronic
No off target data available for this crispr