ID: 1047235549

View in Genome Browser
Species Human (GRCh38)
Location 8:123039231-123039253
Sequence GTGTGTATGGAGGGGGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 9, 3: 66, 4: 602}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047235549_1047235557 6 Left 1047235549 8:123039231-123039253 CCTTCAACCCCCTCCATACACAC 0: 1
1: 0
2: 9
3: 66
4: 602
Right 1047235557 8:123039260-123039282 TCCACTCCACAGAATAGTCGGGG No data
1047235549_1047235556 5 Left 1047235549 8:123039231-123039253 CCTTCAACCCCCTCCATACACAC 0: 1
1: 0
2: 9
3: 66
4: 602
Right 1047235556 8:123039259-123039281 GTCCACTCCACAGAATAGTCGGG No data
1047235549_1047235555 4 Left 1047235549 8:123039231-123039253 CCTTCAACCCCCTCCATACACAC 0: 1
1: 0
2: 9
3: 66
4: 602
Right 1047235555 8:123039258-123039280 AGTCCACTCCACAGAATAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047235549 Original CRISPR GTGTGTATGGAGGGGGTTGA AGG (reversed) Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900481112 1:2899776-2899798 GTGTGTGTGAAGGGGGTTGTGGG + Intergenic
900515631 1:3080934-3080956 GTGTGTGTAGAGGGGGTGGCGGG + Intronic
900527802 1:3137596-3137618 GTGTGGATGGAGGAGGGTGGTGG + Intronic
900650148 1:3726490-3726512 GGGTGGATGGATGGGGTTGGTGG + Intronic
900650184 1:3726626-3726648 GGGTGGATGGATGGGGTGGATGG + Intronic
900650242 1:3726839-3726861 GGGTGGATGGATGGGGTTGGTGG + Intronic
900763547 1:4488574-4488596 GTATGCAGGGAGAGGGTTGAAGG + Intergenic
901101994 1:6726238-6726260 GTGTGTGTGGCGGGGGGTGCGGG - Intergenic
902538379 1:17135125-17135147 GTGTGCATGGAGGAGGTGCATGG - Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902742319 1:18447328-18447350 GTGTGTATGGTGGGGGTTGGGGG + Intergenic
903380985 1:22896705-22896727 GTGTGTATGGTGAGGCCTGAGGG - Intronic
903449495 1:23443093-23443115 GTGTTTATTCAGGGGGATGAAGG + Intronic
905548901 1:38820200-38820222 GTGTGTGTGGAGGTGGTGGGAGG - Intergenic
905784205 1:40739967-40739989 GTGTGTTTAGTGGAGGTTGAGGG + Intronic
906606254 1:47174458-47174480 GTGTGTGTGGAGGGGCGTGGGGG - Intergenic
907429398 1:54403439-54403461 GAGTGTGTGGATGGGGTTGGCGG - Intronic
907489051 1:54797290-54797312 GTGTATATTTAGAGGGTTGATGG + Intronic
907617880 1:55943141-55943163 GTGTGTGTGGAGGGGGGTGGTGG + Intergenic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907856154 1:58305981-58306003 ATGTGTGTGGAGGGGGGTGGGGG - Intronic
908044545 1:60154460-60154482 GTGTGGGTGGTGGGGGTTGGTGG + Intergenic
908311450 1:62888608-62888630 GTGTGTGTGTAAGGGGTTGGTGG + Intergenic
908325999 1:63024352-63024374 GTGTGTGGGGAGGGAGTGGAGGG + Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908696315 1:66845848-66845870 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
908830208 1:68171071-68171093 GTGTGTGTGCAGGGGTTTGGGGG - Intronic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909154608 1:72057611-72057633 GTGTGTGTTGAGGGGCTGGAGGG - Intronic
909285609 1:73813247-73813269 GTGTGTATGGAGGGGGAGGTTGG - Intergenic
910201242 1:84701861-84701883 GTGTGTGTGGGGGGGGGTGGGGG + Intergenic
910227102 1:84947293-84947315 GTGTGTGTGGTGGGGGGTGCAGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
911209974 1:95128757-95128779 GTGTGTGTGGTGGGGGTGGCAGG + Intronic
911357957 1:96844595-96844617 GTGTGTATGGTGGCATTTGAGGG - Intergenic
911549537 1:99262958-99262980 CTGTGTGTGGTGGGGGGTGAGGG + Intergenic
911650949 1:100387860-100387882 GTTTTTTTGGAGGGGGTTGGGGG - Intronic
911745619 1:101438888-101438910 GTGTGTATGGGTGGGGGTGAGGG + Intergenic
912227791 1:107755121-107755143 ATGAGTATGTAGGGGGATGAGGG + Intronic
912452877 1:109778107-109778129 GTGTGCATGGCAGGGGTGGATGG + Intergenic
912930082 1:113950210-113950232 GTATATGTGCAGGGGGTTGAGGG - Intronic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913610710 1:120507261-120507283 TTGTGTTCGGATGGGGTTGAAGG - Intergenic
913702484 1:121386119-121386141 TGGTGTATGAAGGGGGATGAGGG + Intronic
913984097 1:143549628-143549650 TTGTGTTTGGATGGGGTTGAAGG + Intergenic
914043047 1:144066614-144066636 TGGTGTATGAAGGGGGATGAGGG + Intergenic
914135039 1:144893874-144893896 TGGTGTATGAAGGGGGATGAGGG - Intronic
914580480 1:149014978-149015000 TTGTGTTCGGATGGGGTTGAAGG + Intronic
915074799 1:153299186-153299208 GCGTGTATGAAGGGGTTGGATGG - Exonic
915733557 1:158070698-158070720 GTGTGTGTGGTGAGGGTTGTGGG + Intronic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916483084 1:165233044-165233066 GTGTTTATGGTGGGGGTTGTAGG - Intronic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
918142706 1:181732533-181732555 GTGGGCATTGAGCGGGTTGAGGG - Exonic
918395673 1:184111056-184111078 GTGTGTATGGCAGGATTTGAGGG - Intergenic
918531781 1:185530960-185530982 GTGTTTGTGGCAGGGGTTGAAGG - Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918881623 1:190131170-190131192 GTGTGTGTGGCGGGGGGTGGGGG + Intronic
920489913 1:206404862-206404884 TGGTGTATGAAGGGGGATGAGGG + Intronic
920746532 1:208634319-208634341 GTGTGTTTGGAGTGTGTTTATGG + Intergenic
920767018 1:208843159-208843181 GTGAGTGTGGATGGGGTTGGTGG - Intergenic
921232105 1:213083468-213083490 TTGTGTATTGAGTGGGTAGAGGG + Intronic
922585674 1:226733559-226733581 GTGTGTGTGTAGGGGGGTAAGGG - Intronic
922618888 1:226978805-226978827 GTGTGCATGGAGGGTGTGTAAGG - Intronic
922887646 1:229032140-229032162 GTGTGTATGTAGGGGAGTGGGGG - Intergenic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923145825 1:231196954-231196976 CTGTGTAGGGATGGGGTGGACGG + Intronic
923287027 1:232506071-232506093 GTGTGTTTGGAATGGGGTGATGG + Intronic
923826999 1:237511443-237511465 GTCTGCATGGCGGGGGTTCATGG + Intronic
924202434 1:241674045-241674067 GTGTGTGTGTAGGGGGTGGGTGG + Intronic
924850286 1:247822304-247822326 GTGTGTGTGGCGGGGGGGGAGGG + Intergenic
1062831352 10:608159-608181 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831375 10:608228-608250 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831435 10:608418-608440 GTGTGTGTGGGGGGGGCTGGGGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1063362477 10:5469570-5469592 GTGTTTCTGGCGGGGGTTGAGGG - Intergenic
1063378017 10:5565776-5565798 GTGTGGATGGTGGGGGTGGGAGG - Intergenic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1064604594 10:17025878-17025900 GTGTGTGTGGAAGGGATTGCGGG + Intronic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1065153359 10:22845116-22845138 GTGGGGGTGGAGGGGGTCGAGGG + Intergenic
1065375668 10:25038547-25038569 GTGTGTAAGGAGGGTTTTAAAGG + Intronic
1065530334 10:26663154-26663176 GTGTGGATGGAGGGACTTGGTGG - Intergenic
1065734688 10:28740912-28740934 GTGGGTATGGAGGAGTTTGTGGG + Intergenic
1065771347 10:29081626-29081648 GTGAGAATGGAGGAGGTTGTTGG - Intergenic
1066293265 10:34033105-34033127 GTATGTATGGTGGGGGTGGGGGG + Intergenic
1067735215 10:48845318-48845340 GAGTGTGTGGGGGAGGTTGAAGG - Intronic
1068835759 10:61551669-61551691 GTGTGTGTGGAGGGGGGCGGAGG + Intergenic
1069727949 10:70593253-70593275 GTGTATATGGAGGGAGATGATGG + Intergenic
1069828713 10:71269934-71269956 GTGTGTGTGGGAGGGGTTGGGGG + Intronic
1070664515 10:78333719-78333741 GTGTGTGTGGTGGGGGGTGATGG + Intergenic
1070925818 10:80220856-80220878 GTGTCTATGGTGGGGGAGGAAGG - Intergenic
1071145494 10:82565490-82565512 GTGTGTTTGGTGGGGATTGAAGG - Intronic
1071267922 10:83980804-83980826 GTGTGTATGGAGAGAGATGGGGG - Intergenic
1071973501 10:90931604-90931626 GTGTGTATCTTGGGGGGTGAGGG + Intergenic
1072022323 10:91414385-91414407 TTGTGTATAAATGGGGTTGATGG + Intronic
1073053002 10:100681281-100681303 GTGTGTAGGGAAGGGGTTGCAGG - Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073113352 10:101076070-101076092 GTGTGTATTGTGGGGGGTGGCGG - Intergenic
1073930409 10:108567808-108567830 CTGAGAATGGAGGAGGTTGAGGG - Intergenic
1074890536 10:117732652-117732674 GTATATATGGAGGGTGTTGTGGG - Intergenic
1075539793 10:123302511-123302533 GTGTGCATGGTGGGGGTAGGGGG + Intergenic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076853978 10:133106280-133106302 GTGTGAATGGAGGGGAGTGATGG - Intronic
1077293621 11:1813377-1813399 GTGTGTATATAGAGGGTTCAGGG - Intergenic
1078088921 11:8251726-8251748 GTGTGTATGGGGGGGGTATAGGG + Intronic
1078334874 11:10455509-10455531 GTGTGTGTGGATGGGGGTGGGGG + Intronic
1078855087 11:15200688-15200710 GTGTGTGGGGCGGGGGTTGCTGG + Intronic
1078883759 11:15479250-15479272 GAGTGTATGGAAGGGGTGAAGGG - Intergenic
1079566640 11:21890943-21890965 GTGTGAATGTGGGGGGTTGCAGG + Intergenic
1083181306 11:60987582-60987604 GTGTGTATGGTGGGGGGGTATGG + Intronic
1084174978 11:67418350-67418372 GTGGGTGTGGAGGTGGTGGAAGG + Intronic
1084609768 11:70194663-70194685 GTGTGGATGGATTGGGTGGATGG + Intergenic
1084953191 11:72677989-72678011 GTGGGGATGGAGGGAGTGGATGG - Intergenic
1085238190 11:75031387-75031409 TGGAGTATGGAGGGGGTAGATGG - Intergenic
1085548581 11:77345178-77345200 GTGTGTATTGAGAGGTTTGAGGG + Intronic
1086352915 11:85961076-85961098 GTGTGTATGGGGGGTGGTGGGGG + Intronic
1086407075 11:86507592-86507614 ATGTCTATGGAGGAGTTTGAGGG - Intronic
1086544632 11:87953251-87953273 GTGTGTGTAAAGGGGGTTGTAGG + Intergenic
1087429916 11:98040567-98040589 GTGTGTATGTGGGTGGTTGTGGG - Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088223625 11:107594118-107594140 GTGTTTATGGTGGTGGTGGAGGG + Intronic
1088322271 11:108566343-108566365 GTGTGCATGGAGGGGGGTGGTGG + Intronic
1089294261 11:117458525-117458547 GTGTGTATGTAGGGGGTGCGGGG + Intronic
1089457514 11:118634181-118634203 GTGGGTACAGAGGGGGTGGACGG - Intronic
1089841902 11:121425892-121425914 GTGTGTGTGGCGGGGCTTGGTGG - Intergenic
1090465632 11:126930722-126930744 CTGGATATGGAGGGGGTTGGGGG - Intronic
1091196935 11:133739164-133739186 GTGTGTATGGGGGGGTGTGGGGG + Intergenic
1092252981 12:6911506-6911528 GTGTGTGTGGAGGGGGGTGAGGG + Intronic
1092659139 12:10720911-10720933 GTGTATATGAAGTGGGTTTATGG - Intronic
1093913119 12:24769598-24769620 GTGTGTAGGGATGGGGGTCAGGG + Intergenic
1094078824 12:26509996-26510018 GTGTGTGTGGTGGGGGGTGGGGG + Intronic
1094478431 12:30860583-30860605 GTGTGTGTGTTGGGGGTTGGGGG - Intergenic
1095392054 12:41719289-41719311 GTGTGTGTGGCGGGGGAGGAGGG - Intergenic
1096427774 12:51518583-51518605 GTGTATATGGAGGGACTGGAGGG + Intergenic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096705724 12:53420785-53420807 GTGTGTGTGGTGGGGTGTGAGGG - Intergenic
1096804673 12:54133297-54133319 GTGTGTGTGGAGGGGGATAGAGG + Intergenic
1097555192 12:61127793-61127815 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1097921025 12:65073871-65073893 GTGTGTGTGGGGTGGGGTGAGGG + Intronic
1097938269 12:65277899-65277921 AAGTGTGTGGAGGGGGTTGGGGG + Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099755089 12:86835842-86835864 GTGTGTGTGGAGGGGGGTTTTGG - Intronic
1099887054 12:88544532-88544554 GTGTATAGGGATGGGGGTGAGGG - Intronic
1099953377 12:89328493-89328515 GTGAGTATGGTGGGTGTTGAGGG - Intergenic
1100874571 12:98948762-98948784 GTGTGTGTGGGGGGGGGTGTGGG - Intronic
1101583460 12:106064788-106064810 GTGTGTGTGGGGGGGGGTGGGGG - Exonic
1101743601 12:107521090-107521112 GTGTGTATTCAGGGGGCTAAAGG + Intronic
1102009195 12:109607601-109607623 GTGTGTGTGGCGGGGGTGGGGGG - Intergenic
1102029505 12:109731763-109731785 GGGTGTGTGGAGGGGTTTGTCGG + Intronic
1102350937 12:112191541-112191563 GTGTTTATAGAGGGGCTTCAGGG - Intronic
1103007500 12:117433368-117433390 GTGTGTATGGAGTGTGTGTAAGG - Intronic
1103241164 12:119414361-119414383 GTGAGTATGAAGAGGGTTGAGGG - Intronic
1103434601 12:120915142-120915164 GAGAAAATGGAGGGGGTTGAGGG - Intergenic
1103928042 12:124434488-124434510 GGGTCTGTGGAGGGGGTGGAGGG - Intronic
1103949103 12:124541772-124541794 GTGGATATGGAGGGGGATGGGGG + Intronic
1105347706 13:19589245-19589267 GGCTGTGTGGAGGAGGTTGACGG - Intergenic
1105532080 13:21229335-21229357 GTGTGCATGTAGGGGGTTGTGGG - Intergenic
1105830411 13:24159492-24159514 GTGTGGAGGGAGGGGCGTGAGGG - Intronic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106716131 13:32390266-32390288 GTGTGTATGGTGGTGGTTTAAGG - Intronic
1106896631 13:34309868-34309890 GTGTGTTTGGTGGGGGTGGGGGG + Intergenic
1107574656 13:41705282-41705304 GTGTGTGTGCAGGGGGTCGGGGG + Intronic
1108529449 13:51315307-51315329 GTGTGTGTGTAGGGGGTTGAGGG - Intergenic
1109061596 13:57629133-57629155 GTGTGTGTGTCGGGGGTTGGGGG + Intergenic
1109131779 13:58595964-58595986 GTGGGTATAGAGGGGGGAGAGGG + Intergenic
1109193208 13:59350117-59350139 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
1109793118 13:67275698-67275720 GTGTGTATAGAGTGGTGTGATGG + Intergenic
1110322562 13:74176482-74176504 ATGGGTATGGAGTGGGGTGAGGG - Intergenic
1110457231 13:75703146-75703168 GTGTGTGTTGGGGGGGATGAGGG - Intronic
1110940156 13:81340352-81340374 ATGTGGATGGCGGGGGTTGGCGG - Intergenic
1111800208 13:92971852-92971874 GTGGATATGGAGGGGTTTGCTGG - Intergenic
1112298229 13:98207895-98207917 GTGTGTGTGGAGGTGGTGGTCGG - Intronic
1112403844 13:99100403-99100425 GTGTGGATGGATGGTGGTGACGG + Intergenic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1113336104 13:109377519-109377541 ACGTGTATGGATGGGGCTGATGG - Intergenic
1113756499 13:112815286-112815308 GTGTGTCTGAAGGGTGTGGAAGG - Intronic
1113756504 13:112815326-112815348 GTGTGTCTGAAGGGTGTGGAAGG - Intronic
1113884078 13:113648326-113648348 GTGTGTCTGTTGGGGGCTGACGG + Intergenic
1113939731 13:114012324-114012346 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1113939744 13:114012393-114012415 GTGTGTGTGGAGTGTGTGGACGG - Intronic
1114831303 14:26145226-26145248 GTTTGAATGGAGTAGGTTGAGGG - Intergenic
1114895405 14:26983883-26983905 GAGTGAATGGAGGCTGTTGAAGG - Intergenic
1115389646 14:32840740-32840762 GTGTGTGTGGGGGGGGGTGGGGG - Intergenic
1115471301 14:33771311-33771333 GTGTGTATGTGTGGGTTTGAGGG - Intronic
1115752835 14:36507818-36507840 GTGTGTATGTTGGGGGGTGGAGG - Intronic
1115764069 14:36604710-36604732 GTATGTTTGGTGGGGGTTGGAGG + Intergenic
1115864547 14:37729866-37729888 GTGTGAATGTAGGGAGTTGAAGG + Intronic
1116636973 14:47409020-47409042 GTGTGTCTGGAGTGGATTGGTGG + Intronic
1118011168 14:61612036-61612058 GTGTGTGTGGAGGGGGTGGGAGG - Intronic
1118289954 14:64510603-64510625 ATGTGTGTGGAGGAGGGTGAAGG + Intronic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1119390510 14:74288330-74288352 GTGTGTATGCTGGGGAGTGAGGG - Intronic
1119652196 14:76391885-76391907 GTGAGTATCCAAGGGGTTGAGGG + Intronic
1119931722 14:78553998-78554020 GAGTGTGTGGAGGGAGATGAAGG + Intronic
1120121321 14:80682980-80683002 GTGTGTTTGGTGGGGGTGGTGGG - Intronic
1121539916 14:94717827-94717849 GTGTGTGTGGTGGGGGGTGGGGG - Intergenic
1121620651 14:95345852-95345874 GTGTGTGGGGCGGGGGGTGAGGG + Intergenic
1121666004 14:95672891-95672913 GTGTGTATGTTGGGGGTTGGGGG + Intergenic
1121719932 14:96102097-96102119 GTGTGTATGCGTGGGGTTGGGGG + Intergenic
1122606145 14:102948443-102948465 GTGGGTTTGGAGGGAGGTGAGGG + Intronic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1124372520 15:29111655-29111677 GTGGTCATGGTGGGGGTTGAGGG + Intronic
1124403881 15:29377021-29377043 GTGTTTATGGAAGGAGTTGGGGG + Intronic
1124887955 15:33704458-33704480 GTGTGTATGCAGGAGGTGGCTGG - Intronic
1125186225 15:36933594-36933616 GTGTGTGTGGTGGGGGTGGGCGG + Intronic
1125437626 15:39664585-39664607 GTGTGTGTTGGGGTGGTTGAAGG - Intronic
1127151988 15:56085290-56085312 GTGTATGTGGTGGGGGTAGAAGG + Intergenic
1127453775 15:59140082-59140104 GTGTGTATGGGGGTGGGTGCGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128217885 15:65946872-65946894 GGGTGTAGGGAGGGAGTGGAAGG - Intronic
1128283434 15:66416343-66416365 GTGTGTTTGGGGGGGATTGTAGG - Intronic
1129831847 15:78675828-78675850 GTGTGTATGGGTGGGGCTGGGGG + Intronic
1129894352 15:79092389-79092411 GTGTGTGTGGCGGGGGGTGTGGG - Intergenic
1129980109 15:79861296-79861318 AGGTGTATGGAGGGGGACGATGG - Intronic
1130191975 15:81745907-81745929 GTTTCTATGGAGGTGATTGAGGG - Intergenic
1131303409 15:91219733-91219755 GGGTGTGGGGAGGGTGTTGATGG - Intronic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131810257 15:96166074-96166096 GTGTGTAGAGAGGGGGCTCAGGG - Intergenic
1132351004 15:101139731-101139753 GTGTGTGTGGCGGGGGGTTAGGG + Intergenic
1132677692 16:1127421-1127443 GTCTGTAGGGTGGGGGGTGAGGG + Intergenic
1133310858 16:4846262-4846284 TTGCGTATTGAGTGGGTTGAAGG - Intronic
1133397295 16:5458336-5458358 GTGGGGAGGAAGGGGGTTGAGGG + Intergenic
1133638928 16:7698210-7698232 GTGTGTATAAAGGGGGTAGGTGG + Intronic
1133705292 16:8348931-8348953 GTCTGTAGGGTGGGGGGTGAGGG + Intergenic
1133716444 16:8453999-8454021 GTGGGCATGGAGGTGGGTGAGGG + Intergenic
1134904230 16:17965954-17965976 GTGTGTATGTAGGGGATGGGAGG - Intergenic
1135003135 16:18793968-18793990 GTGTGTATGGCGGTGGTGGGTGG + Intronic
1135250693 16:20899593-20899615 GTGTGCATGGGGGAGGATGAGGG + Intronic
1136618987 16:31415510-31415532 GTGTGGATGGAGGTGGGAGAAGG - Intronic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1137698232 16:50477141-50477163 GTGGGTAAGGAAGGGGCTGATGG + Intergenic
1138970440 16:62136299-62136321 GTGTTTATGGGGGGGGGTGAGGG + Intergenic
1140188728 16:72796531-72796553 GTGGGGGTGGAGGGGGTGGAGGG + Exonic
1140608551 16:76570534-76570556 GTGTGTGTGGAGGGGGGTGGGGG - Intronic
1140775640 16:78246783-78246805 GTGTGTTTGGTGGGGAGTGATGG + Intronic
1141229800 16:82155499-82155521 GTGTGTATGTATGGGGTGGAGGG - Intronic
1141297983 16:82787813-82787835 GACTGTATGGAGGGGGGTGAAGG + Intronic
1141539912 16:84712164-84712186 GTGTGTATGGCAGGCTTTGAGGG + Intronic
1141941791 16:87281260-87281282 TTGTGTATGGAGTGGGATGGAGG - Intronic
1142064763 16:88055274-88055296 GTGTGTGCGGAGGGGGTGGGTGG - Intronic
1142172603 16:88630751-88630773 GTGTGTGTGGGGGGGGGTGGGGG - Intronic
1143038792 17:4017055-4017077 GTGTGTGTGAAGGTGGGTGAGGG + Intronic
1143555326 17:7656253-7656275 GTGTGTGTGGCGGGGGGTGTAGG - Exonic
1143871021 17:9957390-9957412 GTGTGGCCGGAGGGGGCTGATGG - Intronic
1143997458 17:11019607-11019629 GTGTGTGTGGTGGGGGGTGGGGG + Intergenic
1144003572 17:11078232-11078254 CAGTGTATGGAGGGAGTGGATGG + Intergenic
1144531050 17:16039723-16039745 GTGTGTATTCAGTGGGCTGATGG - Intronic
1144675756 17:17160537-17160559 GTGTGTAGGGAAGAGGTGGATGG + Intronic
1145297092 17:21600543-21600565 GTGTGGATAGAGGGGGTGTAGGG - Intergenic
1145366865 17:22272355-22272377 GTGTGGATAGAGGGGGTGTAGGG + Intergenic
1145884646 17:28373436-28373458 GTGTGAAGGGAGTGGGTTGGGGG + Intronic
1146544262 17:33724817-33724839 GTGTATGTGTTGGGGGTTGAGGG - Intronic
1146637122 17:34514728-34514750 GTGTGTGTGGAGGGTGGTGCTGG - Intergenic
1147222141 17:38941678-38941700 GTGTGTATTGAGAGGGGAGAGGG + Intronic
1147303061 17:39545192-39545214 GTGTATATAGATGGGGTTGTGGG - Intronic
1147387251 17:40089815-40089837 GTGTGTAGGGGGTGAGTTGAGGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147678255 17:42222210-42222232 GTGTGTTTGGAGGGGCTGGGTGG + Intronic
1147729176 17:42586914-42586936 CTGTGAAAGGAGGGTGTTGAGGG + Intronic
1148088118 17:45006766-45006788 GGGGGTTTGGAGGGGGTTGGAGG - Intergenic
1148346063 17:46904322-46904344 GGGTGGATGGATGGGGTGGATGG + Intergenic
1148657710 17:49300312-49300334 GGGTGTAGGGAGGGTGTTGGGGG + Intronic
1148949483 17:51297952-51297974 GTGTGTGTGTTGGGGGTGGAGGG - Intergenic
1148981655 17:51581428-51581450 GTTTGTATATAGGGTGTTGAAGG - Intergenic
1149345355 17:55728796-55728818 GTGTGTGTGTAGGGGGTAGGGGG + Intronic
1149499177 17:57138507-57138529 GTGTGGATGAAGGGGATTGAAGG - Intergenic
1150220029 17:63491007-63491029 GTGTCCATCGAGGGGGCTGAAGG - Exonic
1151208931 17:72529285-72529307 GTGTGTGTGTAGGGGGGTGGGGG - Intergenic
1151282537 17:73087681-73087703 GGGTGTAAGGATGGGGTTGTGGG + Intronic
1151439032 17:74116284-74116306 GTGTGGGTGGAGGGAGTGGAGGG - Intergenic
1151784068 17:76266401-76266423 GTGTGTGTGGAGGGGGAGGGGGG - Intronic
1151880794 17:76893317-76893339 GTGTGTATGCACGTGGATGATGG + Intronic
1151939475 17:77283397-77283419 GTGGGACTGGAGGGGGCTGATGG + Intronic
1153132818 18:1876952-1876974 GTGTGTGTGGAGGGGGGTGTAGG - Intergenic
1153482848 18:5564834-5564856 TTGTGTATTGAGTGGGTTGGGGG + Intronic
1153591205 18:6675694-6675716 GAGTGTATGGAGGGAGTGGGAGG + Intergenic
1153715193 18:7840052-7840074 GTGTGTATGGGGTGGGGTGGGGG + Intronic
1153858827 18:9177718-9177740 GTGTGGAGGGTGGGGGATGAAGG - Intronic
1153986175 18:10352705-10352727 GTGTGCATGGCAGGGGTTGGGGG + Intergenic
1155665564 18:28304311-28304333 TTGTGTATGGAAGGGGTGTAAGG + Intergenic
1156569365 18:38235527-38235549 ATGTGGATGGAGAGGGCTGATGG + Intergenic
1157700659 18:49759926-49759948 GTGTGTGTGTAGGGGGTGGGGGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159007420 18:63025130-63025152 GGGTGTCTGGTGGGGGATGACGG + Intergenic
1159033565 18:63255824-63255846 GTGTGTGTGGCGGGGGGGGAGGG - Intronic
1160324477 18:77930725-77930747 GTGTGGGTGGAGGGAGTGGAGGG - Intergenic
1161204603 19:3034459-3034481 GGGTGGCTGGAGGGGGTTGGGGG - Intronic
1161641076 19:5423751-5423773 GTGTGGGTGGAGTGGGTGGAGGG - Intergenic
1161663640 19:5561955-5561977 AAGTGTATGGAGGGGGATGATGG + Intergenic
1161895050 19:7073970-7073992 GTGTGTGTGGGAGGGGTTGGTGG - Intronic
1162906980 19:13829960-13829982 ATGTGGCTGCAGGGGGTTGAGGG + Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163084902 19:14972551-14972573 GTCTTTATGTGGGGGGTTGAGGG + Intronic
1163157785 19:15448946-15448968 GTGTGTGTGGAGGGGGGTGAAGG - Intronic
1164538533 19:29105369-29105391 GGGTGTATGTCGGGGGTTGCTGG - Intergenic
1164700802 19:30282605-30282627 ATGTTTAGGGAGGGGGTTGCAGG - Intronic
1164745647 19:30610756-30610778 GTGTGTGTGGAGGCGGGTGGGGG + Intronic
1164754325 19:30678726-30678748 GTGTGTGTGGGGGGGCTTGGGGG - Intronic
1164817615 19:31217162-31217184 GTGTGCATGGCTGGGGTTAAGGG + Intergenic
1164828896 19:31305179-31305201 GTGTGTGTGGAGGGGGTGGCAGG - Intronic
1165136585 19:33673594-33673616 GTGTGTGTGGAAGGGGTTGAAGG + Intronic
1165444324 19:35848588-35848610 CTGAGCATGGAGGGGGCTGAGGG - Intronic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1166066845 19:40365114-40365136 GTGTGTTTGGGGGAGCTTGAGGG + Intronic
1166100788 19:40570411-40570433 GTGTGAAGGGAGGGGGAAGAGGG - Intronic
1166917655 19:46206476-46206498 GTGTGTGTGGGGCGGGGTGAGGG + Intergenic
1167033478 19:46978853-46978875 GTGTGTATGGTGGGGTTTGGTGG + Intronic
1167033501 19:46978945-46978967 GTGTGTGTGGTGGGGTTTGGTGG + Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167114893 19:47483456-47483478 GTGTGTAAGGAGGAGGGCGAAGG + Intronic
1168211194 19:54891702-54891724 TTTTGGATGAAGGGGGTTGAGGG + Intergenic
1168264829 19:55217002-55217024 GCGTCTGTGTAGGGGGTTGAAGG + Intergenic
1168497969 19:56870007-56870029 GTGTGTGTGGAACGGGTGGAAGG - Intergenic
925128858 2:1480547-1480569 GTGTGTGTGTAGGGGGTTTGAGG - Intronic
925291370 2:2750696-2750718 GTGTGTATGGAGTGGTGTGTGGG + Intergenic
925462038 2:4072016-4072038 GTGTGTGTGGTGGGGGGTGTTGG + Intergenic
926222480 2:10945259-10945281 ATGTAGATGAAGGGGGTTGATGG - Intergenic
926243114 2:11103220-11103242 GTGTGTGTGGAGGGCGCAGAGGG + Intergenic
926331615 2:11830205-11830227 GTGTGTATGGCGGAGTTTGGAGG + Intergenic
926372691 2:12196444-12196466 GTGTGTGTGGTGGGGGTAGGAGG - Intergenic
926728923 2:16020046-16020068 GAGTGGAAGGTGGGGGTTGAGGG + Intergenic
926781235 2:16473991-16474013 GTGTGTTTGTAAGGGGTGGAAGG + Intergenic
927260390 2:21082466-21082488 GTGTGTGGGGAGGGGATTGTTGG - Intergenic
928590391 2:32808585-32808607 GTGTGTTTGCAGGGGCATGAAGG - Intronic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
930591581 2:53333900-53333922 GTGTGGAGGGAGGGAGATGATGG - Intergenic
931618060 2:64181630-64181652 GTGTGTATGGAGCGGGAGGCAGG + Intergenic
932417789 2:71584180-71584202 GTGTGTGTGAATGGGGGTGAAGG + Intronic
932586770 2:73035231-73035253 GTGTGGATGGAGGAGGTGGGTGG - Intronic
933474801 2:82776567-82776589 GAGGGAATTGAGGGGGTTGAGGG + Intergenic
933690145 2:85173315-85173337 GTGGGTACGGAGGGGGTGGGGGG + Intronic
933776977 2:85776968-85776990 GTGCGTGTGGAGGGGGTGGGTGG - Intronic
933940513 2:87241077-87241099 GTGTGTTTGGAGGTGTTTGGAGG + Intergenic
934101840 2:88660605-88660627 GTGTGTATGCAGGTGGGGGAGGG + Intergenic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
935463972 2:103373214-103373236 GTCCTTATGAAGGGGGTTGAAGG - Intergenic
936352623 2:111724699-111724721 GTGTGTTTGGAGGTGTTTGGAGG - Intergenic
936472654 2:112812633-112812655 TTTTCTGTGGAGGGGGTTGATGG + Intergenic
937012525 2:118574970-118574992 GTGTGTATGGTGTGGGTAGCAGG - Intergenic
937855127 2:126666692-126666714 GTGTGTAGGGAGGGAGGGGAGGG - Intronic
938106264 2:128532410-128532432 GTGTGTATGGGGGGGTGTGTAGG - Intergenic
938728091 2:134124374-134124396 GTGTGCATGGGAGGGGTTGGAGG + Intronic
939046864 2:137259941-137259963 GTGTGTGTGGTGGAGGTTGTAGG + Intronic
939630681 2:144523733-144523755 GTGTGTGTGGAGGAGGTGGGGGG + Intronic
939839036 2:147164960-147164982 GTGTCCATGGAGGGGGTTGGGGG + Intergenic
940064684 2:149614162-149614184 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
942182942 2:173397565-173397587 GTGTGTGTGGAGGGGGGCGAGGG + Intergenic
942292057 2:174483018-174483040 GTGTGTGTGGCGGGTGTAGAAGG - Intronic
942833226 2:180262023-180262045 GTGTGTGTGGAGGGGTGGGAAGG + Intergenic
943092297 2:183389812-183389834 GTGTGTTTTGAGGGGGCTGCTGG + Intergenic
943287124 2:186016267-186016289 GTGTGTATGGTGGCGGTGGGGGG - Intergenic
943331758 2:186568209-186568231 ATGTGTATGGTGGGGGTAGTGGG + Intergenic
943428262 2:187763753-187763775 TTATGTATGTAGTGGGTTGATGG - Intergenic
944187390 2:196964165-196964187 GTGTGTGTGATGGGGGTTGTTGG + Intergenic
944770639 2:202911250-202911272 GTGAGTGTGGAGGAGGCTGAAGG - Intronic
945442731 2:209899637-209899659 GTGTGTGTAGAGGGTGTGGAAGG - Intronic
946088134 2:217195163-217195185 GTGTGTGTGTAGGGGGTGGGGGG - Intergenic
947107853 2:226686277-226686299 GTGTGTATGGAGGTGGTGGCGGG + Intergenic
947245724 2:228046063-228046085 GTGTGTAGGGGGTGGGATGAAGG - Intronic
948004039 2:234592563-234592585 GTGAGGAGAGAGGGGGTTGAAGG - Intergenic
948253214 2:236547086-236547108 GTGTCTATGGACAGGGGTGATGG - Intergenic
948458560 2:238118458-238118480 GAGTGAATGGAGGAGGTGGATGG + Intronic
948458587 2:238118565-238118587 GAGTGAATGGAGGAGGTGGATGG + Intronic
948563829 2:238871088-238871110 GTGTGTGTTGGGGGGGGTGATGG - Intronic
949077946 2:242073311-242073333 GTGTGGAGGGAGGGACTTGAAGG + Intergenic
1168868491 20:1109063-1109085 GTGTGTGTGGTGGGGGTCGGGGG - Intergenic
1168868527 20:1109294-1109316 GTGTGTATGTAGGGTGGTGGGGG - Intergenic
1169288134 20:4326508-4326530 GTGTGAGGGGAGTGGGTTGAGGG + Intergenic
1169307723 20:4507535-4507557 GTGTGTTTTGAGGGGGTGGAGGG + Intergenic
1169425152 20:5491005-5491027 GTGTGTAGGGATGTGGTTGGGGG - Intergenic
1170247287 20:14236065-14236087 ATGTGTATGGAGGGGTTTTTAGG - Intronic
1170386780 20:15827622-15827644 GTTTATAGGGATGGGGTTGAGGG + Intronic
1170614101 20:17935221-17935243 GTGTGGCTGGATGGGGATGAAGG + Intergenic
1170828648 20:19820427-19820449 CTGTGTTTTGAGGGGGTTTAAGG - Intergenic
1171239590 20:23554227-23554249 GTGGGGAGGGAGGGGGGTGAGGG - Intergenic
1171429257 20:25070447-25070469 GTCTGTGTGCAGGGGGTTGGGGG - Intergenic
1172250443 20:33475769-33475791 GAGAGCATTGAGGGGGTTGAGGG - Intergenic
1172958137 20:38776941-38776963 GTGTGTATGGTGGTGGTTCTAGG + Intergenic
1173057969 20:39634828-39634850 GTGTGTGTGGTGGGGGTGGCAGG + Intergenic
1173547850 20:43913390-43913412 GTGTGTGTGTAGGGGGGTGGTGG + Intergenic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1173727202 20:45306513-45306535 GTGTGTGTGGAGGGGTCTGGGGG - Intronic
1173857826 20:46262211-46262233 GTGTGTGTTGAGGGGGTGGGGGG + Intronic
1173881084 20:46412710-46412732 GTGTGTGGGGGGGGGGTTGTTGG + Intronic
1174210489 20:48874411-48874433 GTGTGTGTGTAGGGGGTGGGTGG + Intergenic
1175050030 20:56146689-56146711 GTGTGTGTGGGGGGGGATGGGGG - Intergenic
1175326796 20:58135171-58135193 GTGTGGAGGCAGGGGGTTTATGG + Intergenic
1175375290 20:58519827-58519849 GTGTGTATGGTGGGGGCTGGGGG + Intergenic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1177686533 21:24444172-24444194 GTGTGTGTGGCGGGGGAGGAGGG + Intergenic
1177848730 21:26321631-26321653 GTGTGGATGAAGGGAGGTGAAGG + Intergenic
1180166025 21:46029609-46029631 GTGTGTGTGGAGGGGGGACAGGG - Intergenic
1180256600 21:46634217-46634239 GTGTGTTGGGCGGGGGTTGGGGG - Intergenic
1180288873 22:10778597-10778619 TTGTGTGTTGAGGGGGTTGGGGG - Intergenic
1181046879 22:20219094-20219116 CTGTGGATGGATGGGGGTGATGG - Intergenic
1181296796 22:21846959-21846981 GTGTGTTTGGCGGGGGTGGGGGG - Intronic
1181340543 22:22176201-22176223 GTGTGTATTGAGGTGGATAAGGG + Intergenic
1181645661 22:24230682-24230704 GTGTGTATTCAGGGAGGTGAAGG - Intronic
1183285292 22:36958901-36958923 GTGTGTTTGTGGGGGGTTGGGGG - Intergenic
1183481589 22:38068440-38068462 GGGTGTATGAAGGGGATTGCTGG - Intronic
1183979244 22:41530115-41530137 GGGGGTAGGGAGGGGTTTGAGGG - Intronic
1184035772 22:41917425-41917447 GTGTGTGTGGTGGGGGGTGGGGG - Intergenic
1184099931 22:42336652-42336674 GTGTGTGTGGAGGGGGTTTAGGG - Intronic
1184239835 22:43206251-43206273 GTGTGTATGTAGGGGTATGTAGG - Intronic
1184796255 22:46735064-46735086 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
1184852462 22:47128301-47128323 GGGTGGGTGGAGGGGGGTGATGG - Intronic
1185007830 22:48294346-48294368 GTGAGTGTGGAGGGGGGTGTGGG + Intergenic
1185204297 22:49528894-49528916 GTGAGTCTGGAGGGGGGTGTAGG + Intronic
1185204321 22:49528984-49529006 GTGAGTCTGGAGGGGGGTGTAGG + Intronic
1185204393 22:49529254-49529276 GTGAGTCTGGAGGGGGGTGTAGG + Intronic
1185204430 22:49529389-49529411 GTGAGTCTGGAGGGGGGTGTAGG + Intronic
949781934 3:7699372-7699394 ATGTGTATGTAGAGAGTTGAAGG - Intronic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
953574151 3:44099385-44099407 GTGTGTGTGGAGGGGAGGGATGG + Intergenic
953813206 3:46132152-46132174 GTGTGTATGCAGGGAGATTATGG + Intergenic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954764114 3:52898275-52898297 GTGTGTGTGCAGGGGGATGTTGG - Intergenic
954853162 3:53620196-53620218 GTGTGTATGGAGGGGCCTGGAGG + Intronic
954934027 3:54310484-54310506 GTGTGTATTGGGGGGGCAGAGGG - Intronic
955569451 3:60288597-60288619 GTGTGTGTGGAGGGGGGTGTGGG + Intronic
955823870 3:62924535-62924557 GTGTGTATTGGGGGGCTTGTAGG - Intergenic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
955841860 3:63120940-63120962 CTGTGTATGGAATGGATTGAGGG + Intergenic
956149929 3:66230443-66230465 GTATGTATGTAGGGGGGTGGAGG + Intronic
956467656 3:69535513-69535535 GTGTGTGTGGTGGGGGTGGCGGG + Intronic
956643312 3:71434660-71434682 GTGTGTAAGGAAGGGGATGGAGG + Intronic
956723640 3:72139182-72139204 GTGGGAATAGAGGGGGCTGATGG + Intergenic
956757206 3:72400631-72400653 GTGTGTATGCATGTGTTTGAAGG - Intronic
956831927 3:73059588-73059610 TTGTGTGTGGAGGGGGTTGAGGG + Intronic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
959689165 3:109179959-109179981 GTGTGTTGGGAGGGAGTTGTAGG - Intergenic
959839743 3:110960392-110960414 GTGTGTGTGGAGGGGGGTGGTGG - Intergenic
960101506 3:113747142-113747164 GTGGGGATAGAGGGGGTGGAAGG + Intronic
960586561 3:119325641-119325663 GTGGGGATGGCGGGGGTTGGGGG + Intronic
960848210 3:122023850-122023872 GGGTCTTTAGAGGGGGTTGAGGG - Intergenic
960998753 3:123358186-123358208 GTGTGTGTGTAGGGAGTTGGTGG + Intronic
961485390 3:127212350-127212372 GTGTGTCTGGAGGTGGGGGATGG - Intergenic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
963767991 3:149357701-149357723 GTGTGTATGGAGGTGGCTGCAGG - Intergenic
963774805 3:149427909-149427931 GTGTGCATGGAGTGGGGTGAGGG + Intergenic
964464846 3:156980445-156980467 GTGTAGATGGCTGGGGTTGAAGG + Intronic
964557353 3:157954161-157954183 GTGTGTGTGGAGGGGGGGGGCGG - Intergenic
965697153 3:171421254-171421276 GTGTGTCTGCAGGGAGTGGAAGG - Intronic
965714525 3:171588303-171588325 GTGTGTCTGCAGGGTGTTGGTGG + Intergenic
966026291 3:175286966-175286988 GAGGGTATGGTGGGGGTGGAGGG + Intronic
966214817 3:177491307-177491329 GTGTGTCTGGAGGCGGGGGATGG + Intergenic
966389151 3:179433345-179433367 GTCTGTGTGGTGGGGGTGGAGGG - Intronic
966890355 3:184403026-184403048 GTGGGTACGGAGAGGGCTGACGG + Intronic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
969325412 4:6441280-6441302 GTCGGTGTGGAGGGGCTTGAAGG - Intronic
969347120 4:6576480-6576502 GTGTGTCTGCATGGGGTTGGGGG - Intronic
969633517 4:8352260-8352282 GTGTACATGGAGGGGGTGAATGG + Intergenic
970069201 4:12137247-12137269 GTGTATATGGAAGGGACTGAGGG + Intergenic
970254382 4:14152254-14152276 GTGTGTTTGGTGATGGTTGAGGG + Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
971412650 4:26391450-26391472 GTGTGTGGGGGGTGGGTTGAAGG - Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973555919 4:52082950-52082972 ATGTGTATGGAGGGGAGGGATGG + Intronic
973773774 4:54228078-54228100 GTGTGTTGGGGTGGGGTTGAGGG + Intronic
975752681 4:77539848-77539870 GTGTGTGTGGTGGGGGTAGGGGG + Intronic
976114261 4:81710204-81710226 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
976280627 4:83323412-83323434 GTGTGTGGGCAGGGGGTTTATGG + Intronic
976484075 4:85580126-85580148 GTGTGTGTGGTGGGGGGGGAGGG + Intronic
977822519 4:101490820-101490842 GTGTGTGTGGTGGGGGTTGGGGG + Intronic
980450868 4:132969869-132969891 GTGTGTGTGCCGGGGGTTTAGGG - Intergenic
981098571 4:140806595-140806617 GTTGGGAGGGAGGGGGTTGAGGG + Intergenic
983828450 4:172295720-172295742 GTGTGTGTGGGAGGGGTAGAGGG - Intronic
985764280 5:1768631-1768653 GGGTGTGTGGGTGGGGTTGAGGG + Intergenic
985773426 5:1826973-1826995 GCGTGAATGGAGAGGGCTGACGG - Intergenic
986643625 5:9895147-9895169 GTGTGTGTGAAGGGGGGTGATGG + Intergenic
986835834 5:11636028-11636050 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
986866904 5:11999953-11999975 GTGTGTGTGGTGGGGGTGGGGGG - Intergenic
987086934 5:14479042-14479064 GTGTGTATGGAGAGTGATGGGGG + Intronic
987372716 5:17207819-17207841 GTGTGGATCCAGGGGGTTGCTGG + Intronic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
988462277 5:31450682-31450704 GAGTGTTGGGAGGGGGGTGAGGG + Intronic
988873737 5:35420227-35420249 CTGTGTGTGAAGGGTGTTGAGGG - Intergenic
990669963 5:58117127-58117149 GTGTGGATGAAGGGGCTGGATGG + Intergenic
990819144 5:59817737-59817759 GTGTGTGTGGGGGGGGGTGTGGG - Intronic
990824100 5:59877923-59877945 GTTTGTGTGTCGGGGGTTGAGGG - Intronic
990863974 5:60359830-60359852 GTGTGTTTTGTGGGGGTAGATGG - Intronic
991475335 5:67012394-67012416 GTGTGTATGGAGGGTGAGGCTGG - Intronic
992246225 5:74826367-74826389 GTGTGTATGGTGGGGCTTGCTGG + Intronic
992443459 5:76814455-76814477 GTGTGTGTGGATGGGGAAGAGGG + Intergenic
992775062 5:80082171-80082193 GTGTGTGTGGAGGGGGGTGGGGG - Intronic
993364365 5:87018727-87018749 GTGTGTGTGGTGGGGGGTGTGGG + Intergenic
994626808 5:102230323-102230345 GTGTTGAAGGAGGGGCTTGATGG - Intergenic
995277801 5:110296881-110296903 GTGTGTATGGGGGCTGTTGGGGG + Intronic
995367312 5:111377502-111377524 GTGAGAATGGAGGGGGGTGGGGG + Intronic
996210074 5:120798076-120798098 GTGTGTGTGGTGGGGGGTGGTGG + Intergenic
997427574 5:133814391-133814413 GTGTGGCTGGAGGGTGTTGGTGG + Intergenic
998149154 5:139747253-139747275 GTGTGTGTGCGGGGGGTTGGGGG - Intergenic
998369345 5:141650991-141651013 GTGTAAATGAAGGGGGTTGGGGG + Intronic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999387932 5:151168534-151168556 GTGTGTTGGGAGGGGGCTGATGG + Intergenic
999418919 5:151423879-151423901 GTGTGTAGGGAGAGGGTATATGG + Intergenic
999879790 5:155849409-155849431 GTGTGTGTGGAGGGGGGTGGTGG - Intergenic
1002467955 5:179417202-179417224 GTTAGGAAGGAGGGGGTTGACGG + Intergenic
1003234344 6:4282358-4282380 GTGTGGGGGGAGGGGGTGGATGG + Intergenic
1003609169 6:7592831-7592853 GTGGGGATGGAGGATGTTGAGGG + Intronic
1004028676 6:11844745-11844767 GGGTGGACGGAGGGAGTTGATGG - Intergenic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004137966 6:12986751-12986773 GGGTGTATGGAGAGCTTTGAAGG + Intronic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004244216 6:13956909-13956931 GTGTGTATGGTGGGGGGCGGGGG - Intronic
1004929944 6:20453263-20453285 GTATGTGTGGAAGGGGTTGGTGG - Intronic
1005194251 6:23264664-23264686 GTGTGTGTGGTGGGGGTGGGTGG + Intergenic
1005338595 6:24821783-24821805 GTAGCTTTGGAGGGGGTTGATGG - Intronic
1005423763 6:25679488-25679510 GTGTGTGTGCAGGGGATTGAAGG + Intronic
1006108603 6:31730804-31730826 GAGAAAATGGAGGGGGTTGAGGG + Exonic
1006181459 6:32155610-32155632 GTGTGTGTGGTGGGGGTGGGGGG + Intronic
1006379012 6:33687146-33687168 GTGTGTTGGGATGGGGATGAGGG + Intronic
1006478603 6:34273802-34273824 ATTTGGAGGGAGGGGGTTGAGGG + Intergenic
1006955233 6:37863813-37863835 GGGTGGATGGATTGGGTTGATGG + Intronic
1007110759 6:39312378-39312400 GTGGGGGTGGAGGGAGTTGAAGG + Intronic
1007183158 6:39945194-39945216 GTGTGTATTGAGGGGAGTGGTGG - Intergenic
1007310751 6:40944303-40944325 GTGTGTATGTCGGGGGGTGGGGG - Intergenic
1007447029 6:41914753-41914775 GTGTGGATGATGGGGGATGATGG - Intronic
1007726061 6:43916297-43916319 GTGTTTGGAGAGGGGGTTGAAGG + Intergenic
1007733448 6:43965750-43965772 GTGTGTATATTGGGGGTTGGGGG - Intergenic
1008289206 6:49692969-49692991 GTGTGTGGGGAGGGGGTAGGAGG + Intronic
1008370312 6:50723824-50723846 GTGTGTATGGCGGGGGTTGGGGG - Intronic
1008456480 6:51716815-51716837 ATGTGGTTGGAGGGGGGTGATGG - Intronic
1008688055 6:53945968-53945990 GTGTGTATGCAGTGGGGTGAGGG + Intronic
1008719847 6:54335780-54335802 GTGTGTTTGCAGGGCGGTGAGGG - Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1010647201 6:78403955-78403977 TTGTGTGTGGGGGGGGTTGGGGG + Intergenic
1011128301 6:84029934-84029956 GTGTGGAAGGAAGGGGTTGCTGG - Intergenic
1011350943 6:86423225-86423247 ATGTGTATGTATGGGGTTGAGGG + Intergenic
1011956545 6:93031016-93031038 GTGTGTAGGGAGGGAATTGGTGG - Intergenic
1012544650 6:100404097-100404119 GGGTGTGTGGAGGTGGTTTACGG - Intronic
1012696806 6:102394375-102394397 GTTGGTATGGATGTGGTTGAAGG + Intergenic
1012790102 6:103682412-103682434 GTGTGTGTGTAGGGGGGTGGGGG - Intergenic
1013743739 6:113320183-113320205 ATGTCTTTGCAGGGGGTTGAGGG - Intergenic
1014199959 6:118598320-118598342 GTGTGTATAGAGGGTGCTGTGGG + Intronic
1015449131 6:133343589-133343611 GTGTGTATGGAGAGGGTCAAGGG - Intronic
1016224856 6:141722795-141722817 GTGTTGAAGGAGGGGGTTGGTGG + Intergenic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1017107603 6:150902701-150902723 GTGTGTAGGTATGGAGTTGAGGG + Intronic
1018019394 6:159745159-159745181 GTGTGAATAGAAGGTGTTGATGG + Intronic
1018302490 6:162418654-162418676 GTGTGTGTTGAGGGGGGGGATGG + Intronic
1018620834 6:165728053-165728075 GTGTGTATGTTGGGGGTGGGTGG - Intronic
1019103463 6:169650304-169650326 GGGTGGATGGAGGGGATGGAGGG - Intronic
1019197756 6:170291829-170291851 GTGTCTGTGGGGGGAGTTGAAGG - Intergenic
1020106335 7:5423864-5423886 GGGTGGTTGGAGGGGGTTGGGGG + Intronic
1020277179 7:6631843-6631865 GTGTGCCTGGAGTGGGCTGAAGG - Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022420825 7:30221750-30221772 CTGTGCATGGTGGGGGTAGAGGG + Intergenic
1023337118 7:39181797-39181819 GTGTGGATGGAGGGAGGTGATGG - Intronic
1023571953 7:41581655-41581677 GTGTGTGTGTAGGTGGTTGGAGG - Intergenic
1023664970 7:42513404-42513426 GTGTGTGTGGAGTGGGATGCAGG + Intergenic
1023761399 7:43468085-43468107 GTGTGTGTGGTGGGGGCTGGTGG - Intronic
1024977526 7:55127457-55127479 GTGTGGGTGGTGGGGGGTGAGGG - Intronic
1026462337 7:70625669-70625691 GTTTGTATAGAGGGGCATGACGG - Intronic
1027180594 7:75936656-75936678 GTGTGTGGGCAGGGGGTTGGGGG + Intronic
1027230431 7:76268787-76268809 CTGTCTTGGGAGGGGGTTGAGGG + Intronic
1027234117 7:76287576-76287598 GTGGGTAGGGATGGGGTAGAGGG + Intergenic
1027831015 7:83177943-83177965 GTGTGTGAGGAGGCGGTTGTGGG - Intergenic
1028091694 7:86710556-86710578 GTGTGTGTGGTGGGGGGTGGGGG + Intronic
1028214453 7:88114443-88114465 GTGTGTCTGGAGGTGATGGATGG + Intronic
1028449367 7:90963648-90963670 GTGCGTATTGAGGGAGGTGAAGG + Intronic
1028773492 7:94655240-94655262 GTGTGTTTGGCGGGCTTTGAAGG - Intronic
1028849469 7:95520644-95520666 GTGTGTGTGGATGGGGATGGGGG - Intronic
1029127034 7:98301691-98301713 GTGTGTGTGGTGGGGGTTAGAGG + Intronic
1029274617 7:99396780-99396802 GTGTGTTGGGAGGGGGTGGGGGG - Intronic
1029643900 7:101839299-101839321 CTGTGCATGGAGGGGCTTGGGGG - Intronic
1029857783 7:103536188-103536210 GGGTTTAAGGAGGGAGTTGAAGG + Intronic
1029863820 7:103603774-103603796 GTGTGTTTGTGGGGGGCTGAGGG + Intronic
1031263236 7:119549356-119549378 GTGTGTGTGGAGGGAGAGGAAGG + Intergenic
1031371840 7:120977625-120977647 GTGTGTGTGGGGGGAGTTGGTGG + Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1031968322 7:128044627-128044649 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1032311586 7:130792421-130792443 GTCTGTGGGGAGAGGGTTGAGGG - Intergenic
1033534275 7:142297951-142297973 GTGTATATGGAGGTTGTTGGAGG + Intergenic
1033569328 7:142612209-142612231 GTGTGTGTGGTGGGGGTCGGGGG + Intergenic
1033636243 7:143213898-143213920 GTGTGTTTGCAGGGGGTAGGAGG - Intergenic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034421478 7:150993272-150993294 GTATGTATGGGGGGAGGTGAAGG + Intronic
1034534930 7:151720729-151720751 GAGGGGATGGAGGGGGATGAAGG + Intronic
1034780707 7:153879291-153879313 GTGTGGATGCTGGGGGTAGAGGG + Intergenic
1035055399 7:156031894-156031916 GTGTGTGTGGTGGGAGCTGAGGG - Intergenic
1035375029 7:158402111-158402133 GTGTGTTTGGAGGGGGTGGCTGG - Intronic
1035636685 8:1152561-1152583 GTGAGTAAGGTGGTGGTTGATGG + Intergenic
1036273167 8:7325881-7325903 GTGTGTGTGGCGGGGGGTGGGGG - Intergenic
1036485720 8:9177229-9177251 GTCTGTATGGTGGGGAATGAGGG - Intergenic
1037110545 8:15159746-15159768 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1037802625 8:22043754-22043776 GTGTGCATGGAGGGAGGTGGGGG - Intronic
1037885085 8:22591669-22591691 GTGAGTGTGGAGGGGGGTGGGGG + Intronic
1038287733 8:26220690-26220712 GTGTGCATGGAGTGGGTTGGGGG + Intergenic
1038308134 8:26422778-26422800 GTGTGTGTAGAGGGGGGTGGGGG + Intronic
1038333201 8:26625913-26625935 CTGTGGATGGAGGGTGGTGATGG - Intronic
1038798057 8:30727142-30727164 GTGTGTAGGGACGAGGGTGACGG - Intronic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1039008703 8:33069615-33069637 GTGTGCCTGGAAGGAGTTGAAGG - Intergenic
1039428629 8:37507196-37507218 GTGTGTGTGGAGGGGGTCTTAGG - Intergenic
1039911103 8:41827971-41827993 GTGTGTGTGTCGGGGGTTGGGGG - Intronic
1040791665 8:51237681-51237703 GTGTGTTTGGGTGGGGTTGGGGG - Intergenic
1041015877 8:53592868-53592890 GTGTGTGTGTTGGGGGGTGAGGG - Intergenic
1041699740 8:60774684-60774706 GTGGGTATGGCGGAGGGTGAAGG + Intronic
1041723464 8:60997168-60997190 GTGTGTGTGGCGGGGGATGGTGG + Intergenic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042334581 8:67616545-67616567 GTGTGTGTTGTGGGGGTTGTGGG + Intronic
1042590513 8:70393528-70393550 GTGTGTATGGGTGGGGGTGGAGG - Intronic
1042927668 8:73983066-73983088 ATGTGTATGAGGGAGGTTGATGG + Intergenic
1043854631 8:85250956-85250978 GTGTGTGTGGTGGTGGATGAAGG + Intronic
1045815434 8:106271409-106271431 GTGTGTATTGCGGGGGTAGGGGG + Intronic
1046243352 8:111527263-111527285 GTGTGTATGGTGGGGTTCCAAGG - Intergenic
1046707490 8:117471367-117471389 GTGTGTGTGGAGTGGGGTGGGGG - Intergenic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1047402350 8:124557573-124557595 GTGTGAAAGGAAGGGGATGAGGG + Intronic
1047668250 8:127116192-127116214 GTGTGTTTGGAGAAGGCTGAGGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048080842 8:131124597-131124619 GTGTGGATGGAGGATGTTGAAGG + Intergenic
1048677567 8:136800615-136800637 GTGTGTGTGGCGGGGGTTGGGGG + Intergenic
1048843742 8:138587136-138587158 GTGTGTATGTGGGTGGTTGGGGG + Intergenic
1049572925 8:143378058-143378080 ATGTGTATGGAGGGGCCTGGTGG - Intronic
1049582277 8:143418200-143418222 GTGTGTGGGTAGGGGGTTGGAGG - Intergenic
1050260694 9:3837984-3838006 TTGTGTGTGGAGGGGGTGGGGGG + Intronic
1051535688 9:18154969-18154991 GAGTGTATGGTGAGGGTTGCTGG + Intergenic
1051982014 9:23031686-23031708 GTGTGTATGTAGTGGAATGATGG - Intergenic
1052965229 9:34335570-34335592 GTGTGTATAGAGTGGGTAGGAGG + Intronic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1053504368 9:38628846-38628868 GTGTGTATGGGGGGTGTTTATGG - Intergenic
1054703574 9:68438828-68438850 GTGTGTATGTTGGGGGAGGAGGG + Intronic
1055349340 9:75370110-75370132 GTGTGTATGTAGAGGGTGCAGGG - Intergenic
1056753818 9:89370076-89370098 GTGTGTATGGGGGTGGTTTTAGG + Intronic
1056899826 9:90587474-90587496 GTGTGTGTGCACGGGGTTGTGGG + Intergenic
1057255242 9:93541083-93541105 GTGTGTGTGGTGGGGTTTGTTGG + Intronic
1057581190 9:96289227-96289249 GTGTGTATGGAAGTGGGTAATGG + Intronic
1057801769 9:98195401-98195423 GTGTGTGTGGTGGGGGTGGGGGG + Intergenic
1057952817 9:99383604-99383626 GTGTGAATGGAGGGGTAGGAGGG - Intergenic
1057956797 9:99416237-99416259 GTGTGTCTGCAGGGGTTGGATGG - Intergenic
1058109426 9:101016087-101016109 GTGTATATGGAGGAGCTTAATGG + Intergenic
1059935172 9:119303265-119303287 GTGTGTGTGGTGGGGGTGGGGGG - Intronic
1059950135 9:119453900-119453922 GTGTGTGTGGGGGGGGATGGGGG - Intergenic
1059967511 9:119629932-119629954 GTGTGTATGGTGGGGGGAGGAGG - Intergenic
1060812237 9:126616279-126616301 GTGTGTATTGAGGAGGGAGATGG + Intronic
1060912445 9:127361871-127361893 GTGTGTTTGGGGTGGGGTGAGGG - Intronic
1061619341 9:131801348-131801370 GTGCGTGTGTAGGGGGGTGAGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1189344894 X:40233417-40233439 AGGTGTATGGAGGGGCTTGGGGG - Intergenic
1189472798 X:41327355-41327377 GTGTGTATGCAGGGATTAGAAGG + Intergenic
1190259755 X:48790457-48790479 GTGTGTGTGGATGGGGGAGAGGG + Intronic
1190331089 X:49235814-49235836 GTGTGTGTGTAAGGGGGTGAGGG - Intronic
1190404016 X:50068232-50068254 GTGTGTGTGGAGGTGGGGGAGGG - Intronic
1190561634 X:51691654-51691676 GTGTGTGTGGTGGGGGTGGGAGG + Intergenic
1190562657 X:51701661-51701683 GTGTGTGTGGTGGGGGTGGGAGG - Intergenic
1192138948 X:68631181-68631203 GTGTGTATGGAGGGGAAAGCGGG - Intergenic
1192859258 X:75048369-75048391 ATGTGTTTGTATGGGGTTGAGGG + Intergenic
1195058995 X:101175927-101175949 GTGGGTTTGGTGGGGGTTGGCGG - Intergenic
1195129314 X:101838586-101838608 GTGTGTGTGGGGGGGGGTGGCGG + Intronic
1195273732 X:103257816-103257838 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1195280364 X:103327362-103327384 GGGTGTATGGTGAGGGTTGTGGG + Intergenic
1195594600 X:106673673-106673695 GTGTGTGTGGGGGGGGATGGGGG - Intronic
1195718627 X:107843663-107843685 GTGTGTGTTGCGGGGGTGGAGGG + Intronic
1195906358 X:109848518-109848540 TGGTGGATGGAGGGGGTGGAGGG - Intergenic
1196734758 X:118974120-118974142 GTGTGTGTGGGGGGGCTTCACGG + Intergenic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1198098202 X:133400899-133400921 GTGTGTCTGCAGGGGGTGGGGGG + Intronic
1198927731 X:141817715-141817737 GTATGTATGTAGGAGGTAGAGGG + Intergenic
1198986378 X:142458867-142458889 GTGTGTGTGGTGGGGGATGTGGG - Intergenic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic
1200222758 X:154399643-154399665 GTGTATGTGGGTGGGGTTGAGGG - Intronic
1201500279 Y:14634692-14634714 GTGTGTGTGAATGGTGTTGAAGG + Intronic
1201789642 Y:17825412-17825434 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1201811912 Y:18080577-18080599 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic
1202351293 Y:23995162-23995184 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1202519486 Y:25674957-25674979 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic