ID: 1047237438

View in Genome Browser
Species Human (GRCh38)
Location 8:123054248-123054270
Sequence GCATTCAGCTGAAGCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047237438_1047237443 10 Left 1047237438 8:123054248-123054270 CCAGCTGAGCTTCAGCTGAATGC 0: 1
1: 0
2: 4
3: 20
4: 170
Right 1047237443 8:123054281-123054303 GGCCTTGGCTGTACCATGCAGGG No data
1047237438_1047237440 -5 Left 1047237438 8:123054248-123054270 CCAGCTGAGCTTCAGCTGAATGC 0: 1
1: 0
2: 4
3: 20
4: 170
Right 1047237440 8:123054266-123054288 AATGCAACCATGAGAGGCCTTGG No data
1047237438_1047237442 9 Left 1047237438 8:123054248-123054270 CCAGCTGAGCTTCAGCTGAATGC 0: 1
1: 0
2: 4
3: 20
4: 170
Right 1047237442 8:123054280-123054302 AGGCCTTGGCTGTACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047237438 Original CRISPR GCATTCAGCTGAAGCTCAGC TGG (reversed) Intronic
900217553 1:1489840-1489862 GGGTTCAGCAGAGGCTCAGCAGG - Intronic
900952320 1:5865016-5865038 GCATTCAGCTGGAGCACAGTGGG - Intronic
904676325 1:32201228-32201250 GGCTGCAGCTGAAGCCCAGCAGG + Intronic
905895018 1:41540090-41540112 GCTTCCAGCTGCAGCTCCGCAGG - Intronic
906068569 1:43000513-43000535 GAATTCAGGAGCAGCTCAGCTGG - Intergenic
906528679 1:46511112-46511134 AGACTCAGGTGAAGCTCAGCAGG - Exonic
906675798 1:47693032-47693054 GCATCCATCTGCAGCTCTGCAGG + Intergenic
908040032 1:60102574-60102596 CCATTCAGCTGAAGCTGAGATGG - Intergenic
908708573 1:66989956-66989978 TCACTCAGCTAAAGCACAGCTGG - Intergenic
911332648 1:96542845-96542867 ACACTCAGCTGACGCTGAGCAGG + Intergenic
912436155 1:109662491-109662513 GAATTCAGGTGATGCCCAGCAGG + Intronic
912513733 1:110205380-110205402 GCAAACATCTGAAGCTCAGCTGG - Intergenic
914513684 1:148355316-148355338 GCAGTGAGCTGAAGCTGAGATGG + Intergenic
917163960 1:172090680-172090702 GCATTCAACTGAAGGTGGGCAGG - Intronic
917961588 1:180149896-180149918 GCAGTCAGCTGAAGCTAGGTTGG - Intergenic
919824830 1:201496053-201496075 ACATTTGGCTGAAGCGCAGCTGG - Intronic
922194564 1:223348836-223348858 GCTTTCAGCAGAATCTCAGATGG - Intronic
922731185 1:227949461-227949483 ACATGCACCTGAAGCTCACCTGG - Intergenic
923277419 1:232409730-232409752 GCATGCAGCTGCAGCTCAGCTGG - Intronic
1062900247 10:1138462-1138484 GCTTTCAGCTGAAGATGAGAAGG + Intergenic
1066488945 10:35875481-35875503 GCATTCAGCTGAATCATGGCAGG + Intergenic
1068955182 10:62815001-62815023 GCCCTCGGCTGAAGCGCAGCGGG - Intronic
1070869091 10:79732493-79732515 GCATTTATCTGAAGCTGAGCAGG - Intergenic
1070945745 10:80390234-80390256 GCATTGAGCTGGATCTCAGTAGG + Intergenic
1071636004 10:87254678-87254700 GCGTTTATCTGAAGCTGAGCAGG - Intergenic
1071659236 10:87483266-87483288 GCGTTTATCTGAAGCTGAGCAGG + Intergenic
1073040685 10:100602566-100602588 CCTTTCAGCTGATGTTCAGCAGG - Intergenic
1075816750 10:125270540-125270562 GTACCCAGCTGCAGCTCAGCAGG - Intergenic
1079622603 11:22572348-22572370 GTAGTCAGCTGGAGGTCAGCTGG + Intergenic
1084664117 11:70567048-70567070 GCATTCAGCAGCAGCTCAGAGGG - Intronic
1089623480 11:119736384-119736406 GCAACCTGCTGAAGCCCAGCTGG + Intergenic
1090683872 11:129093800-129093822 ACATTAAGCTGATGCTCACCCGG - Intronic
1090908364 11:131096813-131096835 CCACTCATCTGAACCTCAGCTGG - Intergenic
1091694583 12:2619305-2619327 CCATTCAGATGAAACTCAGCCGG + Intronic
1092700764 12:11228374-11228396 GCATTCAGGAGCAGCTTAGCTGG + Intergenic
1099984640 12:89648828-89648850 GCAGTCTCCTGAAGCTGAGCAGG - Intronic
1100063406 12:90609633-90609655 GCATTCAGGTGAAGTTTAGCTGG - Intergenic
1103216381 12:119204765-119204787 GAATTCAGCTGAGGCTCAGCTGG + Intronic
1104149480 12:126068981-126069003 GGATTTAACTGAAGCTCAGAGGG - Intergenic
1105620570 13:22061911-22061933 GCCTGCAGCTGAAGCACAGCTGG - Intergenic
1111278715 13:85989566-85989588 GCATGCCGCTGTAGCTGAGCAGG - Intergenic
1111639384 13:90947768-90947790 GTATTCTACTGCAGCTCAGCTGG - Intergenic
1112415980 13:99203789-99203811 ACATTGAGCTGAGGCTCAGATGG + Intronic
1113090511 13:106613044-106613066 GAATTCAGGTACAGCTCAGCTGG - Intergenic
1113816592 13:113175924-113175946 GCTCTCACCTGGAGCTCAGCAGG - Intergenic
1117771210 14:59136229-59136251 CCATTCAGGAGAAGCTCAGGGGG - Intergenic
1118019312 14:61695266-61695288 GCGGTCAGCTGAGGCACAGCTGG - Intergenic
1119133753 14:72197718-72197740 GTTTTCAGCTGGAGGTCAGCTGG + Intronic
1119869762 14:78006990-78007012 GCATCCAGGTGAGGCTTAGCAGG + Intergenic
1120473503 14:84957358-84957380 GCATAAAGCTGCAGTTCAGCTGG + Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1123947936 15:25247945-25247967 GCTCCCAGCTGAAACTCAGCGGG + Intergenic
1128711068 15:69872378-69872400 CCCTTCAGCTGAAGTTCTGCTGG + Intergenic
1129863107 15:78878759-78878781 ACATTTAGCTGAAGGTAAGCAGG + Intronic
1130206498 15:81880392-81880414 TCATGCAGCTGAAGTTCATCTGG + Intergenic
1130401351 15:83557590-83557612 GCAGTCACCTGCAGGTCAGCTGG + Intronic
1131010174 15:89010935-89010957 TCAGCCAGCTTAAGCTCAGCTGG + Intergenic
1131446282 15:92500382-92500404 GCATTCAGCTCAAGCAAATCTGG - Exonic
1131604757 15:93889716-93889738 ACAGTCACCTGAAGCTTAGCTGG - Intergenic
1133130146 16:3671751-3671773 ACATTCCCCTGAACCTCAGCCGG - Exonic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1136105099 16:28024831-28024853 GCACTTAGCTGAGGCTGAGCAGG + Intronic
1137030657 16:35521070-35521092 GCATTGAGCTGAAGCTCCAGAGG - Intergenic
1137301717 16:47155270-47155292 GCATTCAGCTTCATCACAGCAGG - Exonic
1139349818 16:66327933-66327955 TCATTCAGCAGAGACTCAGCTGG - Intergenic
1140341337 16:74166737-74166759 TCTTTCTGCAGAAGCTCAGCTGG - Intergenic
1141059132 16:80848831-80848853 GCTTTAAGCTGTAGGTCAGCTGG + Intergenic
1141535017 16:84673170-84673192 GCTTTCAGATTAAGCACAGCCGG + Intergenic
1141553320 16:84820572-84820594 GCATTCAGCTGCAGTTTAGAGGG + Intronic
1141663517 16:85454029-85454051 GCATCCAGCTTCAGCCCAGCTGG + Intergenic
1142508088 17:378405-378427 GCATTCAGGGGCAGCTCAGAAGG - Intronic
1143058072 17:4177350-4177372 GCTTGCAGATGAAGCTCAGGAGG - Intronic
1146403344 17:32517685-32517707 GCATTTATCTGAAGCAAAGCGGG - Intronic
1146725151 17:35150210-35150232 GCATTCAGGAGAAGGTGAGCTGG + Exonic
1151988044 17:77556587-77556609 GGACTCAGCTGGAGCTGAGCAGG - Intergenic
1154305523 18:13228000-13228022 GCAGACGGCAGAAGCTCAGCTGG + Intronic
1156890588 18:42185729-42185751 GCATTCAGCTGGAGGACAGATGG - Intergenic
1157502015 18:48197628-48197650 GCCCTCAGCAGAAGCTCAACTGG - Intronic
1161170667 19:2810924-2810946 GCCTGCAGCTGCATCTCAGCTGG - Intronic
1162373614 19:10292743-10292765 GCATTTAGCTGAAGCTGGGCGGG - Exonic
1162381540 19:10334629-10334651 GCATTTAGCTGAAGTTGAGCTGG + Exonic
1163683663 19:18697988-18698010 GTACTCAGCTGGTGCTCAGCAGG + Intronic
1165125723 19:33595696-33595718 GCATTTAGGTGGAGCTCAGCTGG + Intergenic
1166165320 19:40983915-40983937 GTCTTCAGCAGATGCTCAGCGGG - Intergenic
1166507554 19:43380595-43380617 GCATTCACCTGCAGCACTGCCGG + Intergenic
1168472679 19:56652227-56652249 GCTCTCAGGTGAAGCCCAGCGGG + Intronic
925933045 2:8725976-8725998 GACTGCAGCTGAAGCTCCGCAGG + Intronic
928102228 2:28445779-28445801 GCACTCACCTGGAGCTCAGAAGG + Intergenic
928360572 2:30659193-30659215 TCAAGAAGCTGAAGCTCAGCAGG - Intergenic
933477047 2:82803997-82804019 GAATTGAGCTGAAGCTGAGATGG + Intergenic
934576838 2:95407257-95407279 GCATTCAGCAGAAACTCTACAGG + Intronic
936990883 2:118364831-118364853 GCATTTAGCTGAGGCTCAGCTGG - Intergenic
937209079 2:120256153-120256175 GCAGTCATCTGAAGCTCGACTGG + Intronic
937342733 2:121101537-121101559 GCATCCAGCTGCACCTCGGCTGG - Intergenic
938991565 2:136635215-136635237 GCATTCAGGAGAGGCTTAGCTGG + Intergenic
941549141 2:166892573-166892595 GCAGGCAGGTGAAGCTCTGCAGG - Intronic
943385535 2:187200295-187200317 GCATTCAGCTGGAGTTAAGATGG - Intergenic
946639288 2:221766169-221766191 GCACCCTGCTGAAGTTCAGCTGG + Intergenic
948839943 2:240643921-240643943 TCATTAAACTAAAGCTCAGCTGG - Intergenic
1169462394 20:5807042-5807064 GCTTTCAGCTGGAGCCCTGCAGG + Intronic
1169805558 20:9555912-9555934 GCAGTCAGCTGGCTCTCAGCAGG - Intronic
1170341736 20:15336241-15336263 GCTTTTAGATGAAGCTCAGTAGG + Intronic
1170373992 20:15679838-15679860 GAATTCAGATGATGCACAGCAGG - Intronic
1171429443 20:25071917-25071939 GGGTTCAGCTGAAGGTCATCAGG + Intronic
1171904288 20:30888108-30888130 GCCCTCAGCTGAAGGTCTGCTGG + Intergenic
1174132227 20:48353412-48353434 GGAGTCAGCTGAAGAGCAGCAGG - Intergenic
1174216000 20:48916807-48916829 GCAGTCAGATGAGGCTCAACTGG - Intergenic
1175399092 20:58690011-58690033 GCAATCAGCTGAGTCTAAGCAGG + Intronic
1176205172 20:63884270-63884292 GAGTTCAGCTGAAACTCAGGGGG - Intronic
1177837781 21:26204701-26204723 GCATTCTGCTTAGGCTCTGCTGG + Intergenic
1178475774 21:32935829-32935851 GGATTCAGGAGAAGCTTAGCTGG + Intergenic
1179932059 21:44577404-44577426 GACCTCAGCAGAAGCTCAGCAGG - Intronic
1184308495 22:43625582-43625604 GCACTGAGCCGGAGCTCAGCTGG + Intronic
1184449897 22:44576622-44576644 GCAGGCATCTGAGGCTCAGCAGG + Intergenic
1184780443 22:46646424-46646446 GCATTCAGAGGAAGGTCTGCAGG - Intronic
1185179687 22:49352036-49352058 GAAGTCAGCTGGAGCTCAGGCGG - Intergenic
950259705 3:11535184-11535206 GCACTCAGCTAAGGCTCAGCAGG - Intronic
950538332 3:13594733-13594755 GCTTTCAGGTGACACTCAGCTGG + Intronic
950710075 3:14807678-14807700 GCACAGAGCTGATGCTCAGCAGG + Intergenic
950856794 3:16113283-16113305 GCATTCAGCCGGAGCTTGGCTGG - Intergenic
952217508 3:31292446-31292468 GCTTTAAGCTGAAGTCCAGCTGG + Intergenic
955218858 3:57007377-57007399 GCCTTCTGCTGAGGCTGAGCTGG + Intronic
956352800 3:68356355-68356377 GGATAAAGCTCAAGCTCAGCAGG + Intronic
956952903 3:74302757-74302779 ACATTCAGCTGAAACACAGTGGG - Exonic
957388337 3:79527850-79527872 GCATCCAGTTGAAGTTCAGCAGG + Intronic
964376135 3:156050914-156050936 GCAATCACTGGAAGCTCAGCAGG + Intronic
965427975 3:168550794-168550816 GCAATGAGATGAAGCTGAGCAGG + Intergenic
966911240 3:184561629-184561651 GCACTCAGCTGGAGTTCAGTTGG - Intronic
967188803 3:186967662-186967684 GCCTTCAGCTTTGGCTCAGCAGG + Intronic
968076932 3:195821171-195821193 GCCCTCAGCTGTAGCTCATCAGG + Intergenic
968193494 3:196688370-196688392 CCATCAAGCTGAAGCCCAGCAGG + Intronic
970164196 4:13219061-13219083 GCTTTCAGCTGAAACACAGAAGG + Intergenic
972356841 4:38287286-38287308 GCATTCAGCGGCATCTCAGGAGG + Intergenic
973150906 4:46887328-46887350 GCATTCAGATGAAGGTCATGTGG - Intronic
974828208 4:67155981-67156003 GAACTCAGATGAATCTCAGCTGG + Intergenic
976701655 4:87975829-87975851 GCATTCAGCTGAATTTCATGGGG + Intronic
976932032 4:90578624-90578646 GCAATCAGCTGAAGTTGAGATGG - Intronic
979611141 4:122690045-122690067 GCAGTCATCTGCAGCTCACCTGG - Intergenic
980188262 4:129490350-129490372 GCTTACAAGTGAAGCTCAGCAGG - Intergenic
982201415 4:152964645-152964667 GCATTTGGCTGCAGCTCAGCAGG - Intronic
984253606 4:177364226-177364248 GGGTTCAGCTGGAGCTCACCAGG - Intergenic
986786501 5:11119104-11119126 GCATTCAGCTGAGGAGGAGCTGG + Intronic
987434136 5:17872934-17872956 GTTTTCAGCTGAAGTTCAGGAGG - Intergenic
993507949 5:88734225-88734247 GCTGTCAGCTGAAGGTCAGATGG + Intronic
993522815 5:88924909-88924931 GTATTTAGCTGAAGCTAAGAGGG - Intergenic
993552443 5:89290554-89290576 GAATTGAGCTGAAGCTCTTCTGG - Intergenic
998799288 5:145853026-145853048 GCAGTCATCTCAAGCTCAACTGG + Intergenic
999730792 5:154475671-154475693 GCGCTCAGCAGAAGCTCCGCGGG + Exonic
1001038539 5:168315477-168315499 CCCTTCAGCTGAAGTTCACCAGG - Intronic
1001693987 5:173655996-173656018 GCATTCAGCTGGAGCTGACTGGG + Intergenic
1004493689 6:16143052-16143074 GTATTCAGCTGAAGCCTGGCTGG - Exonic
1006724689 6:36189247-36189269 GCCTTATGCTGAAGCTCACCTGG - Intergenic
1007916474 6:45566126-45566148 GCATTCAGCTGGAGTTGGGCTGG + Intronic
1008625314 6:53309853-53309875 GCATTCATCTGAAGCTGAGCAGG - Intronic
1009278072 6:61710656-61710678 CCATTGAGCTGAATCTCAGGAGG - Intronic
1010645393 6:78381752-78381774 GCATTCAGGGGCAGCTCATCTGG + Intergenic
1011082711 6:83507364-83507386 GTAGTCAGCTGAAGCTAAGTAGG - Intergenic
1011579339 6:88841845-88841867 GCATTCAGAAGAAGGCCAGCTGG - Intronic
1012273882 6:97248348-97248370 GCATTCAGGAGAAGCTTAGCTGG - Intronic
1013592295 6:111629376-111629398 GCAGACACCTGAAGCTTAGCAGG - Intergenic
1014191205 6:118498812-118498834 ACATTCATCTCAAGCTCACCTGG + Intronic
1016229326 6:141783701-141783723 GCATTCAGCTAAAGTCCAGTGGG + Intergenic
1017344516 6:153365088-153365110 TCATATAACTGAAGCTCAGCAGG + Intergenic
1018065713 6:160123982-160124004 GCTTTGAGCTGAGCCTCAGCTGG + Intronic
1019012292 6:168851532-168851554 GGATGCAGCTGAAGCCCACCTGG + Intergenic
1022243195 7:28532332-28532354 GAATTCAGCAGCAGCTTAGCTGG - Intronic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1026207882 7:68273961-68273983 GCTTTCAGCTGCACCTCAGCTGG - Intergenic
1029581691 7:101440515-101440537 GCATTCAGGTGAGACTCAGGGGG + Intronic
1033502434 7:141965515-141965537 CCATTCTACTGAAGCTAAGCTGG + Intronic
1038033248 8:23663136-23663158 GCAATTAGCTGAAACTCAGATGG + Intergenic
1040868559 8:52076562-52076584 GCATTCAGAGAAGGCTCAGCAGG + Intergenic
1042557919 8:70049468-70049490 GCAGTCAGCAGAAACACAGCTGG + Intergenic
1045062746 8:98423398-98423420 GCATGCGGCTGGAGCACAGCTGG + Intronic
1047237438 8:123054248-123054270 GCATTCAGCTGAAGCTCAGCTGG - Intronic
1047626950 8:126666192-126666214 GAATTCACCTGAAGCTCTGGTGG + Intergenic
1047971873 8:130091543-130091565 GCATTTATCTGAAGCTCAAAAGG + Intronic
1051152192 9:14094355-14094377 GCATTCAGCTGAAAAGCAACTGG - Intronic
1053228521 9:36384331-36384353 GTAAACAGCTGAAGCTCAGAGGG + Intronic
1055210085 9:73781040-73781062 GGATTCAGATCAAGCTCAGCAGG + Intergenic
1055885421 9:81057286-81057308 GGCTTCAGCTGGAGCTCAGCTGG - Intergenic
1056424758 9:86465307-86465329 CCATCCTGCTGAAGCTGAGCTGG + Intergenic
1058773634 9:108263592-108263614 GCATTCAGATTAAGCCCTGCTGG - Intergenic
1058897692 9:109414283-109414305 GCATTCAGCAGGACCCCAGCTGG - Intronic
1060222654 9:121772850-121772872 GCAGGCCGCTGCAGCTCAGCTGG + Exonic
1060883730 9:127136236-127136258 GCAGCCAGCTGGAGCTCAGGGGG - Intronic
1061778175 9:132979927-132979949 GCGGTCAGGTGCAGCTCAGCTGG - Intronic
1190052053 X:47157757-47157779 TCATGCAGCTGAACCTCAGCCGG - Intronic
1191099845 X:56713854-56713876 AAATTCAGGTGCAGCTCAGCTGG - Intergenic
1191766256 X:64701804-64701826 GAATTCAGCTGAAATTCATCTGG + Intergenic
1195974911 X:110516180-110516202 GCAGCCAGCTGAAGCCCATCTGG - Intergenic
1199285818 X:146053208-146053230 GAATACAGATGAAGCTTAGCTGG - Intergenic
1199595340 X:149502517-149502539 GCCTTCTGCAGGAGCTCAGCTGG - Intronic
1200062673 X:153490530-153490552 GCATGAAGCTCATGCTCAGCGGG - Intronic
1202093707 Y:21221501-21221523 CCATGCTGCTGAAACTCAGCTGG + Intergenic