ID: 1047241525

View in Genome Browser
Species Human (GRCh38)
Location 8:123093993-123094015
Sequence GGTTCTGATGGAGGAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 0, 2: 3, 3: 84, 4: 893}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047241525_1047241531 18 Left 1047241525 8:123093993-123094015 CCAGCCTTTCCTCCATCAGAACC 0: 1
1: 0
2: 3
3: 84
4: 893
Right 1047241531 8:123094034-123094056 CTACAATAATCATCAACGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047241525 Original CRISPR GGTTCTGATGGAGGAAAGGC TGG (reversed) Intronic
900250187 1:1664869-1664891 GGCTCTGAGGGAGGACAGACAGG + Exonic
900261220 1:1730775-1730797 GGCTCTGAGGGAGGACAGACAGG + Intronic
900624137 1:3600477-3600499 TGCTCTGAAGGAGGACAGGCGGG + Intronic
900745871 1:4360448-4360470 GCTACTGGTGGAGGCAAGGCCGG - Intergenic
901396559 1:8986338-8986360 GGTTCTCACGGAGGAATGGCAGG + Intergenic
901435825 1:9246980-9247002 GGTTCTGGTCTCGGAAAGGCAGG - Exonic
902783819 1:18720562-18720584 GGTGCTGATGGAGAGAAGGGAGG + Intronic
904187612 1:28717852-28717874 AGCTCTGATGGAGGAAAGAAGGG - Intronic
904824979 1:33268496-33268518 GGTTCTGATGATGGAAAGGCAGG + Intronic
904998924 1:34652880-34652902 AGTTCTGATGGAGGCAAGACTGG - Intergenic
906382302 1:45340496-45340518 GGGGCTGATGGAGGCATGGCGGG + Intronic
906431045 1:45756011-45756033 AGTCCTGAGGGAGGAAAGGGTGG + Intergenic
907144443 1:52219613-52219635 AGTCCTGAGGGAGGAAAGGGTGG + Intronic
908458289 1:64325469-64325491 GGTTATGATGGAGAAAAGGAGGG + Intergenic
908789636 1:67768978-67769000 GGGTCTGGGGGAGGAAAGGAGGG + Intronic
909445368 1:75743128-75743150 AGAGCTGATGGAAGAAAGGCAGG + Intronic
910474779 1:87595388-87595410 GGTTATGAGGGAAGAATGGCTGG + Intergenic
912089515 1:106054236-106054258 GGAGCTGATGCTGGAAAGGCAGG + Intergenic
912466411 1:109877753-109877775 GGGTGTGCTGGAGGACAGGCGGG + Intergenic
912581035 1:110721138-110721160 GGTTCTGACGGATAAAAAGCGGG + Intergenic
914655906 1:149740512-149740534 GCTTCTGAGGCAGGCAAGGCGGG - Intergenic
914812262 1:151037624-151037646 GGAGCTGAAGGAGGAATGGCAGG + Exonic
915065841 1:153223183-153223205 GCTTCTAAAGGAGGAAAGACAGG - Intergenic
916087828 1:161284002-161284024 GTTTCTGATGGAGATAATGCTGG - Intronic
917514717 1:175697946-175697968 GGTTCTCATGATGGAAAGGCAGG - Intronic
917926391 1:179792553-179792575 TGTTCTCATGGCAGAAAGGCTGG + Intronic
918084741 1:181236121-181236143 GGTTCTGATGGGGGCTGGGCTGG - Intergenic
918149499 1:181785784-181785806 GGTCCTGCTGGAGGTAAGGCAGG - Exonic
918285562 1:183051378-183051400 GATGGGGATGGAGGAAAGGCTGG - Intronic
918748827 1:188243780-188243802 GGTTCTGAGGGAGGATAAGGTGG + Intergenic
919324580 1:196090505-196090527 GGTTCAGCTGAAGGAAAGGCAGG + Intergenic
920907866 1:210188573-210188595 GGTTTTGAAGGAGGAATGGAGGG - Intergenic
921225213 1:213012393-213012415 GGTTGTGATGGGGGCAAGACTGG + Intronic
921264248 1:213409356-213409378 GGTTCTGACTGAGGAAGGCCAGG + Intergenic
923845687 1:237729063-237729085 GGTGGTGATGGAGGGAAGGATGG - Intronic
923847756 1:237755648-237755670 GGTACTGCTGGAGCAATGGCTGG - Intronic
923995867 1:239493831-239493853 GAACCTGATGCAGGAAAGGCAGG + Intronic
924464853 1:244290728-244290750 GGCCCTGAAGTAGGAAAGGCTGG + Intergenic
924854740 1:247864923-247864945 GGGTCTGCTGGAGGTGAGGCCGG + Exonic
1063651242 10:7939296-7939318 GAGTCTGATGGAGAAAAGGGAGG - Intronic
1064321538 10:14309941-14309963 GGTTCAGAAGGAGGGAATGCGGG - Intronic
1064645183 10:17453635-17453657 GATTCTGGTGGAGGAAAGCAGGG - Exonic
1067144917 10:43687982-43688004 GGTTTGGATGGAGGAGAAGCAGG + Intergenic
1067272208 10:44802288-44802310 GGTTCTGATGGTGCACAGGTGGG - Intergenic
1069587640 10:69619068-69619090 GCTTAGGATGGAGGAAAGTCAGG - Intergenic
1069756523 10:70777164-70777186 GATCCTGAAGGAGGAAAGCCTGG + Exonic
1070640730 10:78167060-78167082 TGTTCTGATGGAGGAAAAAGGGG + Intergenic
1070761193 10:79025359-79025381 GGTCCTGCTGCAGGAAGGGCTGG + Intergenic
1071736226 10:88303709-88303731 GGCACTGATGGAGGTAAGGCTGG - Intronic
1071882165 10:89911206-89911228 GGTGCTGGTGGAGGTAGGGCTGG + Intergenic
1074114586 10:110446194-110446216 GGTACAGATGGAGGAAATGGAGG - Intergenic
1074154088 10:110783157-110783179 GGAGCTGATGGAGCAAAGGCTGG + Intronic
1074615409 10:115062430-115062452 ACTTCTGAAGGAAGAAAGGCTGG - Intergenic
1075616539 10:123893894-123893916 GGTTCTGATGGAGGTGGTGCAGG - Intronic
1076055843 10:127372217-127372239 TGTACTGATCGAGGACAGGCAGG + Intronic
1076146084 10:128123993-128124015 GGTTCAGATGGAGAACAGACAGG - Intronic
1076485862 10:130816591-130816613 GGTGATGACTGAGGAAAGGCAGG - Intergenic
1077441074 11:2569519-2569541 GCTTCTGAGGGAGGACAGGCAGG + Intronic
1078071015 11:8110451-8110473 TTCTCTGATAGAGGAAAGGCAGG + Exonic
1078546654 11:12252093-12252115 GGCTTTGTGGGAGGAAAGGCAGG - Intronic
1079850765 11:25531107-25531129 GGTACTGATGGTGGTAAGTCTGG + Intergenic
1080072442 11:28106479-28106501 GGTTCAACTGGAGGGAAGGCCGG + Intronic
1084252176 11:67908438-67908460 GGTTCTGGTGGTGGGTAGGCAGG - Intergenic
1084553841 11:69864414-69864436 GGCTGTGGGGGAGGAAAGGCAGG + Intergenic
1084820673 11:71687595-71687617 GGTTCTGGTGGTGGGTAGGCAGG + Intergenic
1084907270 11:72357804-72357826 GGTTCTGCTGGAAGAGAGGCAGG + Intronic
1086121712 11:83311638-83311660 AGATGAGATGGAGGAAAGGCTGG + Intergenic
1089000431 11:115047617-115047639 GGTTCTGAGGGTGGAGAGGCAGG - Intergenic
1089362980 11:117903453-117903475 TGTTCTGAGGGAAGAAAAGCAGG + Intronic
1090251100 11:125252541-125252563 GTTTCAGATGGAGAAATGGCAGG + Intronic
1090685709 11:129116098-129116120 GTTTCTGCTGGGGGAAAGGGAGG + Intronic
1091426014 12:389870-389892 TGTTTTGATGGAGAAGAGGCGGG - Intronic
1091758421 12:3071471-3071493 GGTGATGATGGAGGAAGGGCAGG + Intergenic
1092141408 12:6186228-6186250 GGCTCTGATGGAGGGATGGTGGG - Intergenic
1093854776 12:24087932-24087954 GGGTGTAATGAAGGAAAGGCAGG + Intergenic
1095626960 12:44326462-44326484 AGGACTGATGGAGGAAAGGGAGG + Intronic
1096071485 12:48777866-48777888 GGCTCTGATGGGGGAAGGTCAGG - Intronic
1097264912 12:57739006-57739028 GGTGCTGGTGGAGAAAAGGTGGG - Intronic
1097332962 12:58352474-58352496 GGTTTGGATGGAGGAAACGTGGG + Intergenic
1098574029 12:72020456-72020478 GGTTGTGATGGAGGGTAGGAAGG + Intronic
1099296938 12:80840090-80840112 GGTACTGATGGGAGAGAGGCAGG - Intronic
1101087849 12:101254520-101254542 GGTTCTGACAAAGGATAGGCTGG - Intergenic
1102192457 12:110999012-110999034 GGCTCTGATTTAGGAGAGGCTGG + Intergenic
1102575457 12:113853576-113853598 GGTCCTGAAGGAAGAAAGGAAGG - Intronic
1104244452 12:127024318-127024340 GACTCTGAAGGAGGAAGGGCGGG + Intergenic
1104379139 12:128291684-128291706 GGATCTGAGGAAGGAAAGGCAGG - Intronic
1104765558 12:131327912-131327934 GTTTCTGTTGGAGGAAAGACGGG - Intergenic
1107803470 13:44132162-44132184 GGCGGTCATGGAGGAAAGGCTGG + Intergenic
1109250627 13:60015663-60015685 GGTTGAGAGGGAGGAAAGGGTGG + Intronic
1110705496 13:78599248-78599270 GGTTCTGATAGAAGTAAGGGAGG + Exonic
1110972055 13:81776199-81776221 GGTTCAGAGGGAGAAAGGGCAGG - Intergenic
1111633809 13:90877441-90877463 GGTTCTAATGCAGGGAAGGGAGG + Intergenic
1112209708 13:97363490-97363512 GCTTCCGATGGAGGGAAGGGCGG + Intronic
1113011617 13:105774125-105774147 GGTTCTGTTAGAGGAATGACTGG + Intergenic
1114217667 14:20668964-20668986 GGTTCGGATGGGGGATTGGCTGG + Intergenic
1114360612 14:21968245-21968267 GGTTGAGATGGGGGAAAGGCTGG + Intergenic
1116734030 14:48665889-48665911 GGGTGGGATGGAGGAAAGGGAGG - Intergenic
1116802429 14:49456732-49456754 GCTTTGGATGGAGGAAAGGAAGG + Intergenic
1118318075 14:64737692-64737714 CATTCTCATGGTGGAAAGGCTGG - Intronic
1118419998 14:65591558-65591580 GATACTGTTGGATGAAAGGCAGG + Intronic
1119471444 14:74902600-74902622 AGAGCTGATGGAAGAAAGGCAGG - Exonic
1120997131 14:90425545-90425567 GGCACTGGTGGAGGGAAGGCTGG + Intergenic
1121050543 14:90816584-90816606 GGGCCCGAGGGAGGAAAGGCGGG + Intergenic
1121790731 14:96697717-96697739 GGTTCTGGCCGAGGAAATGCAGG - Intergenic
1122034319 14:98936402-98936424 GGTTCTGATAAAAGAGAGGCAGG + Intergenic
1123468174 15:20531239-20531261 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1123649941 15:22469825-22469847 GGTGCTGAGGGAGGAGGGGCAGG - Intergenic
1123728490 15:23126449-23126471 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1123740344 15:23278644-23278666 GGTGCTGAGGGAGGAGGGGCAGG - Intergenic
1123746654 15:23323914-23323936 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1124158863 15:27251751-27251773 GGTTCTGTAGGGGGAAATGCAGG + Intronic
1124278922 15:28347230-28347252 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1124303777 15:28564378-28564400 GGTGCTGAGGGAGGAGGGGCAGG - Intergenic
1124630085 15:31331254-31331276 GGTTCTGCAGGAGGGAAGGCTGG - Intronic
1124649476 15:31464436-31464458 AGTTCTGGAGGAGGAGAGGCGGG - Intergenic
1124693989 15:31848179-31848201 GGTGCTGAGCAAGGAAAGGCAGG + Intronic
1125715435 15:41817305-41817327 GGATCTCATGGAGGGAAGGTGGG + Intronic
1125730838 15:41892112-41892134 GGGTGTGTTGGAGGAAAGCCAGG - Intronic
1127264839 15:57353028-57353050 GGTTGTGGTGGGAGAAAGGCTGG - Intergenic
1128086290 15:64888860-64888882 GTGTGTGAAGGAGGAAAGGCAGG - Intronic
1131791680 15:95972394-95972416 GTTTCTGCTGGAGGAAGGGCAGG + Intergenic
1132518391 16:376473-376495 GGTTTGGCTGGAGGAAAGTCTGG + Intronic
1132854141 16:2037306-2037328 GGTTCAGGTGCAGGAATGGCCGG - Intronic
1133332270 16:4982123-4982145 GGCCCTGGTGGAGGACAGGCAGG + Intronic
1134058974 16:11187715-11187737 GCTGCTGATGGAGGAAAGCAGGG - Intergenic
1134101136 16:11452408-11452430 GGGGCTGCTGGAGGAAAGGCAGG + Intronic
1135632442 16:24046708-24046730 GGTGACGCTGGAGGAAAGGCAGG + Intronic
1136368598 16:29821484-29821506 GGTTCTGGGGGAGCAGAGGCTGG + Intronic
1136500676 16:30668541-30668563 GGATCTGTGGGAGGAAAGGGGGG - Exonic
1140217968 16:73023425-73023447 GGGGCGGAGGGAGGAAAGGCTGG + Intronic
1140958057 16:79885736-79885758 GGATCTCATGGATGAATGGCAGG - Intergenic
1141105577 16:81230695-81230717 GGTTCTGAGGAAGGAAAGCTTGG - Intergenic
1142030649 16:87836802-87836824 GGTCTTGAAGGAGGAAAGGAGGG + Intronic
1143740157 17:8946739-8946761 GGTCCTGAGGCAGGAGAGGCAGG - Intronic
1144629123 17:16861438-16861460 AAGTGTGATGGAGGAAAGGCCGG + Intergenic
1146480610 17:33202164-33202186 GGTTCTGATGCAGGCAGGCCAGG - Intronic
1147937558 17:44021698-44021720 GGTTCTGATGAAGGAAGTGGTGG - Intronic
1148074254 17:44926496-44926518 GGAACTGAGGGAGGAAAGGAGGG + Exonic
1148256717 17:46140051-46140073 GGTTGGGATGGAGGAAGGGAAGG - Intronic
1148764562 17:50029508-50029530 GGTTCTGATGGAGGACATAGAGG + Intergenic
1151106749 17:71624223-71624245 GGTCCTTATAAAGGAAAGGCAGG + Intergenic
1151288811 17:73133584-73133606 AGCTCTGATGGAGAAGAGGCTGG - Intergenic
1152132511 17:78485625-78485647 GGTGCTGATGGGGGACAAGCTGG - Exonic
1152815472 17:82405172-82405194 AGTTCTCATGGAGCAAAGGCCGG - Intronic
1152928816 17:83099859-83099881 GGTTCTGAGGGGCGGAAGGCAGG + Intergenic
1154194851 18:12258111-12258133 GTCACTGCTGGAGGAAAGGCTGG - Intronic
1155551662 18:26972010-26972032 GGTTGTGATGGAGGTGTGGCAGG + Intronic
1156967893 18:43117995-43118017 AGTTTTGTTGGAAGAAAGGCAGG - Intergenic
1157988040 18:52462281-52462303 GGTTCTGAATGAGGAAATGCTGG - Intronic
1158542133 18:58366771-58366793 GAGTCTGAAGGAGGAATGGCTGG - Intronic
1160090276 18:75820364-75820386 GGGTTTGGTGGAGGAAAGGCAGG + Intergenic
1160528392 18:79550056-79550078 GGTGCGGATGGCGGGAAGGCAGG + Intergenic
1160528404 18:79550110-79550132 GGTGCGGATGGCGGGAAGGCAGG + Intergenic
1160528426 18:79550214-79550236 GGTGCGGATGGCGGGAAGGCAGG + Intergenic
1160528580 18:79550912-79550934 GGTGCGGATGGCGGGAAGGCAGG + Intergenic
1160713170 19:562658-562680 GGTCCGGAGGGAGGAAAGGGTGG + Intergenic
1161255621 19:3307595-3307617 GGCTTTGATGGAGGACAGACAGG - Intergenic
1161470257 19:4453639-4453661 GCTTCTGCTGGAGGTCAGGCTGG + Intronic
1162574635 19:11491914-11491936 GGATCTGATGGAGGGGAGGGAGG - Intronic
1163121514 19:15221060-15221082 AGTTATGAGGGAGGAAAGCCAGG - Intergenic
1163142324 19:15358192-15358214 GGTGCTCATGGAGAGAAGGCTGG - Intronic
1164560650 19:29289762-29289784 TGTTCTGATGGAGGAAACACTGG + Intergenic
1164778483 19:30873102-30873124 GCAGCTGATGGAGGAAAGGGAGG + Intergenic
1165620173 19:37239508-37239530 GGTTCTGATGGGGAAAAGCTTGG + Intronic
1165833887 19:38743297-38743319 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165833912 19:38743369-38743391 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165833938 19:38743441-38743463 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165833964 19:38743515-38743537 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165833976 19:38743550-38743572 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165834027 19:38743698-38743720 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165834039 19:38743733-38743755 GGGTCTGAGGGAGGAAGGGCTGG - Intronic
1165834084 19:38743878-38743900 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1165834382 19:38745344-38745366 GGGTCTGAAGGAGGAGGGGCTGG - Intronic
1165886832 19:39084516-39084538 GGTACAGATGGGGGAAGGGCAGG + Intronic
1165906288 19:39196693-39196715 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1165906314 19:39196767-39196789 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1165938349 19:39403061-39403083 GGATCTGATCGAGGACAGGCTGG + Intergenic
1165938388 19:39403167-39403189 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1165938403 19:39403207-39403229 GGATCTGAGGGAGGAGGGGCTGG + Intergenic
1165938458 19:39403350-39403372 GGTTCCGAGGGAGGAGGGGCTGG + Intergenic
1165938492 19:39403425-39403447 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1166297084 19:41894730-41894752 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166297096 19:41894766-41894788 GGTTCTGAGGGAGGAGGGGATGG + Intronic
1166297111 19:41894803-41894825 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166297123 19:41894836-41894858 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1166297151 19:41894906-41894928 GGCTCTGAGGGAGGAGGGGCTGG + Intronic
1166297212 19:41895080-41895102 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166297223 19:41895113-41895135 GGGTCTGAGGGAGGAAGGCCTGG + Intronic
1166297238 19:41895149-41895171 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166305389 19:41934608-41934630 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1166306167 19:41938210-41938232 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306233 19:41938437-41938459 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306245 19:41938474-41938496 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306258 19:41938511-41938533 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306273 19:41938548-41938570 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306288 19:41938585-41938607 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306304 19:41938623-41938645 GGGTCTGAGGAAGGAAGGGCTGG - Intergenic
1166306353 19:41938773-41938795 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306375 19:41938847-41938869 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306401 19:41938920-41938942 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306415 19:41938956-41938978 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306428 19:41938993-41939015 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306443 19:41939030-41939052 GGGTCTGAGGGAGGAGACGCGGG - Intergenic
1166306456 19:41939067-41939089 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306471 19:41939104-41939126 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306486 19:41939141-41939163 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306501 19:41939178-41939200 GGGTCTGAGGAAGGAAGGGCTGG - Intergenic
1166306562 19:41939367-41939389 GAGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306582 19:41939441-41939463 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306608 19:41939514-41939536 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306621 19:41939550-41939572 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1166306634 19:41939587-41939609 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306649 19:41939624-41939646 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306664 19:41939661-41939683 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306678 19:41939696-41939718 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166306707 19:41939770-41939792 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166313436 19:41975954-41975976 GGGTCTGAGGGAGGAAGGTCTGG - Intronic
1166313490 19:41976103-41976125 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166313573 19:41976317-41976339 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166315008 19:41984842-41984864 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166316245 19:41991745-41991767 GGGTCTGAGGGAGGAGGGGCAGG + Intronic
1166316258 19:41991781-41991803 GGGTCTGAGGGAGGAAGGACTGG + Intronic
1166316285 19:41991854-41991876 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166316299 19:41991889-41991911 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166316314 19:41991924-41991946 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166316339 19:41991995-41992017 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1166316352 19:41992031-41992053 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1166316390 19:41992137-41992159 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166332344 19:42086353-42086375 GGTAAGGATGGAGGAAAGGCAGG + Intronic
1166341209 19:42138378-42138400 GGTCCTGAAGGATGAAAGGAAGG + Intronic
1166382577 19:42362649-42362671 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166382592 19:42362686-42362708 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166382631 19:42362796-42362818 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1166382645 19:42362832-42362854 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166382660 19:42362869-42362891 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166382671 19:42362906-42362928 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166382696 19:42362975-42362997 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166384011 19:42370384-42370406 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166387737 19:42391475-42391497 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1166502636 19:43353297-43353319 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1166504273 19:43361634-43361656 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166504378 19:43361918-43361940 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166521939 19:43486546-43486568 AGGTCTGAGGGAGGAGAGGCTGG + Intronic
1166525330 19:43507056-43507078 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166525358 19:43507130-43507152 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166525372 19:43507167-43507189 GGGTCTGAGGAAGGAAGGGCTGG - Intronic
1166525384 19:43507204-43507226 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166525409 19:43507278-43507300 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166525424 19:43507315-43507337 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166525514 19:43507557-43507579 GGGTCTGAAGGAGGAGGGGCTGG - Intronic
1166525599 19:43507784-43507806 GGGTCTGAGGGAGGAGAGGCTGG - Intronic
1166525612 19:43507821-43507843 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166531542 19:43546277-43546299 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166531564 19:43546349-43546371 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166531579 19:43546386-43546408 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166532649 19:43552325-43552347 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166532693 19:43552434-43552456 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166532724 19:43552508-43552530 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166532753 19:43552582-43552604 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166532781 19:43552656-43552678 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166532798 19:43552693-43552715 GAATCTGAGGGAGGAAGGGCTGG - Intronic
1166546202 19:43636008-43636030 GGGTCTGATGGAGGAGGGTCTGG - Intronic
1166546215 19:43636045-43636067 GGATCTGATGGAGGAGGGGCTGG - Intronic
1166568703 19:43780349-43780371 GGATCTGAGGGAGGAGAGGTTGG - Intronic
1166568714 19:43780386-43780408 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166568727 19:43780422-43780444 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166568741 19:43780459-43780481 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166569501 19:43784788-43784810 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1166569599 19:43785110-43785132 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1166662138 19:44654138-44654160 GGGTCTGAGGGACGAGAGGCTGG + Intronic
1166662180 19:44654247-44654269 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166662194 19:44654285-44654307 GGGTCTGAGGGAGGAGAAGCTGG + Intronic
1166676900 19:44746420-44746442 GGGTCTGATGGAGGAAATAAGGG - Intergenic
1166679687 19:44759023-44759045 GGGTCTGAAGGAGGAGGGGCTGG - Intronic
1166679775 19:44759294-44759316 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166679788 19:44759329-44759351 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682712 19:44778448-44778470 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682728 19:44778484-44778506 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682756 19:44778557-44778579 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682772 19:44778593-44778615 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682800 19:44778666-44778688 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682816 19:44778702-44778724 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682845 19:44778776-44778798 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682861 19:44778812-44778834 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166682889 19:44778885-44778907 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166683361 19:44781435-44781457 GGGTCTGAGGGAGGAAGGGCCGG + Intronic
1166683374 19:44781471-44781493 GGATCTGAGGGAGGAGGGGCCGG + Intronic
1166683403 19:44781544-44781566 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166683433 19:44781619-44781641 GGGTCTGAGGGAGGAGGGGCCGG + Intronic
1166683446 19:44781656-44781678 GGGTCTGAGGGAGGAAGGCCTGG + Intronic
1166683559 19:44781949-44781971 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166683573 19:44781985-44782007 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166683585 19:44782022-44782044 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166683597 19:44782059-44782081 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166685452 19:44793696-44793718 GGGTCTGAGGGAGGAGAGACTGG + Intronic
1166686731 19:44800786-44800808 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686752 19:44800858-44800880 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686763 19:44800894-44800916 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686783 19:44800966-44800988 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686825 19:44801110-44801132 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686846 19:44801182-44801204 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686869 19:44801254-44801276 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686890 19:44801326-44801348 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686922 19:44801434-44801456 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686943 19:44801506-44801528 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166686984 19:44801650-44801672 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166687005 19:44801722-44801744 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166687060 19:44801902-44801924 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166687087 19:44801975-44801997 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166687114 19:44802048-44802070 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1166688827 19:44810927-44810949 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166688841 19:44810963-44810985 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166688854 19:44810999-44811021 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166688879 19:44811072-44811094 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166688891 19:44811108-44811130 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166689199 19:44812614-44812636 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166695817 19:44851058-44851080 GGGTCTGAGGGAGGAGAGGCTGG - Intronic
1166699498 19:44874133-44874155 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1166712237 19:44944930-44944952 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1166712957 19:44948934-44948956 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166712984 19:44949007-44949029 GGGTCTGAGGGAGGACGGGCTGG - Intronic
1166712998 19:44949044-44949066 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1166794845 19:45420024-45420046 GGATCTGAGGGAGGAGGGGCTGG - Intronic
1167031247 19:46962556-46962578 GTTTCTGATGGAGAAAAGTTCGG + Intronic
1167152551 19:47718627-47718649 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167152578 19:47718698-47718720 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167152591 19:47718734-47718756 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167152603 19:47718770-47718792 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1167152616 19:47718805-47718827 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167248662 19:48389855-48389877 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167248690 19:48389929-48389951 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167248720 19:48390003-48390025 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167248746 19:48390075-48390097 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167248758 19:48390110-48390132 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167248786 19:48390184-48390206 GGGTCTGAGGGAGGAGGGGCCGG - Intronic
1167248825 19:48390295-48390317 GGGTCTGAGGGAGGAGGGGCCGG - Intronic
1167249275 19:48391996-48392018 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167249289 19:48392033-48392055 GGGTCTGAGGGAGGAGAGGCTGG - Intergenic
1167249300 19:48392070-48392092 GGATCTGAGGGAGGAGGGGCTGG - Intergenic
1167249364 19:48392249-48392271 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167249388 19:48392323-48392345 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167249405 19:48392360-48392382 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167249422 19:48392397-48392419 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167249439 19:48392434-48392456 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167249644 19:48393219-48393241 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167264899 19:48478609-48478631 GGGCCTGATGGAGGAGGGGCTGG + Intronic
1167264913 19:48478645-48478667 GGGTCTGATGGAGGAGGGGCAGG + Intronic
1167264926 19:48478681-48478703 GGGTCTGATGGAGGAGGGGCTGG + Intronic
1167264939 19:48478717-48478739 GGGTCTGACGGAGGAGGGGCTGG + Intronic
1167264952 19:48478753-48478775 GGGTCTGACGGAGGAGGGGCAGG + Intronic
1167264965 19:48478789-48478811 GGGTCTGACGGAGGAGGGGCCGG + Intronic
1167264982 19:48478826-48478848 GGGTCTGACGGAGGAGGGGCCGG + Intronic
1167264997 19:48478863-48478885 GGGTCTGACGGAGGAGGGGCCGG + Intronic
1167265029 19:48478937-48478959 GGGTCTGAGGGAGGAGGGGCCGG + Intronic
1167265044 19:48478974-48478996 GGGTCTGAGGGAGGAGGGGCCGG + Intronic
1167265060 19:48479011-48479033 GGGTCTGAGGGAGGAGGGGCCGG + Intronic
1167265810 19:48482764-48482786 GGGTCTGAGGGAGGAGGGGCCGG - Intergenic
1167265823 19:48482800-48482822 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167265953 19:48483133-48483155 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167265969 19:48483170-48483192 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167265985 19:48483207-48483229 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167266001 19:48483244-48483266 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167266017 19:48483281-48483303 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167266060 19:48483391-48483413 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167266086 19:48483464-48483486 GGATCTGAGGGAGGAGGGGCTGG - Intergenic
1167266112 19:48483543-48483565 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167276627 19:48543861-48543883 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1167276675 19:48543999-48544021 GGATCTGAGGGAGGAGGGGCTGG - Intergenic
1167276711 19:48544108-48544130 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167276726 19:48544145-48544167 GGATCTGAGGGAGGAGGGGCTGG - Intergenic
1167276788 19:48544328-48544350 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167276804 19:48544365-48544387 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167276820 19:48544402-48544424 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167276870 19:48544550-48544572 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167276922 19:48544698-48544720 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167286101 19:48599634-48599656 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167298311 19:48664465-48664487 GGATCTGAGGGAGGAGGGGCTGG - Intronic
1167314334 19:48755148-48755170 GGATCTGAGGGAGGAGGGGCTGG - Intronic
1167314658 19:48756529-48756551 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314675 19:48756566-48756588 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314688 19:48756603-48756625 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314704 19:48756640-48756662 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314718 19:48756675-48756697 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314729 19:48756712-48756734 GGGTTTGAAGGAGGAAGGGCTGG + Intronic
1167314928 19:48757582-48757604 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314945 19:48757619-48757641 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167314959 19:48757655-48757677 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167314973 19:48757691-48757713 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167315027 19:48757837-48757859 GGGTCTGAGGGAGGCAGGGCTGG + Intronic
1167322958 19:48807571-48807593 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167327315 19:48834541-48834563 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327341 19:48834615-48834637 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327367 19:48834689-48834711 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327380 19:48834726-48834748 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327393 19:48834763-48834785 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327406 19:48834800-48834822 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327445 19:48834910-48834932 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167327458 19:48834947-48834969 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327509 19:48835094-48835116 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327560 19:48835241-48835263 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327590 19:48835315-48835337 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327672 19:48835571-48835593 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167327947 19:48836738-48836760 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167327961 19:48836775-48836797 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167327974 19:48836811-48836833 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167328000 19:48836884-48836906 GGGTCTGAGGGAGGAAGGGGTGG - Intergenic
1167328184 19:48837610-48837632 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167328197 19:48837647-48837669 GGGTCTGATGGAGGAGGGGCTGG - Intronic
1167328211 19:48837684-48837706 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167328226 19:48837721-48837743 GGATCTGAGGGAGGAGGGGCTGG - Intronic
1167342070 19:48922088-48922110 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167342994 19:48927111-48927133 GCTTGTTCTGGAGGAAAGGCTGG + Intergenic
1167368145 19:49065290-49065312 GGGTCTGAGGGAGGAGGGGCCGG - Intergenic
1167387386 19:49171833-49171855 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167413770 19:49360168-49360190 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167414442 19:49362666-49362688 TGATCTGAGGGAGGAGAGGCTGG + Intronic
1167425802 19:49429083-49429105 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167425828 19:49429154-49429176 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167425873 19:49429263-49429285 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167432127 19:49461159-49461181 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432140 19:49461195-49461217 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432166 19:49461267-49461289 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432179 19:49461303-49461325 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432192 19:49461339-49461361 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432203 19:49461375-49461397 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432214 19:49461411-49461433 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432228 19:49461446-49461468 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432252 19:49461519-49461541 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432266 19:49461556-49461578 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432599 19:49462891-49462913 GGGTCTGAAGGAGGAGGGGCTGG + Intronic
1167432624 19:49462962-49462984 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432638 19:49462998-49463020 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432664 19:49463069-49463091 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432679 19:49463105-49463127 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432693 19:49463142-49463164 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432704 19:49463179-49463201 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167432718 19:49463216-49463238 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432733 19:49463253-49463275 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432758 19:49463324-49463346 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432772 19:49463360-49463382 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432786 19:49463397-49463419 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432799 19:49463434-49463456 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167432813 19:49463471-49463493 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432828 19:49463508-49463530 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432853 19:49463579-49463601 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432867 19:49463615-49463637 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432881 19:49463652-49463674 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432894 19:49463689-49463711 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167432908 19:49463726-49463748 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167432923 19:49463763-49463785 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167435509 19:49476349-49476371 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167441668 19:49512804-49512826 GGGTCTGAGGGAGGAGTGGCTGG + Intronic
1167441785 19:49513106-49513128 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460137 19:49620716-49620738 GGGTCTGAGGGAGAAGAGGCTGG + Intronic
1167460151 19:49620753-49620775 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167460166 19:49620790-49620812 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460190 19:49620864-49620886 GGTTCTGAGGGAGGAGAGGCTGG + Intronic
1167460236 19:49621000-49621022 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460249 19:49621036-49621058 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460276 19:49621108-49621130 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460297 19:49621160-49621182 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460311 19:49621196-49621218 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167460334 19:49621270-49621292 GGGTCTGAGGGAGGAGCGGCTGG + Intronic
1167460346 19:49621307-49621329 GGGTCTGAGGGAGGAGCGGCTGG + Intronic
1167474480 19:49691964-49691986 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167474494 19:49692000-49692022 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167474520 19:49692073-49692095 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167478216 19:49713126-49713148 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167478230 19:49713162-49713184 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167478245 19:49713199-49713221 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167478261 19:49713236-49713258 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167495984 19:49818859-49818881 GGGTCTGAGGGAGGAAGGGCTGG + Intronic
1167496016 19:49818968-49818990 GGGTCTGAGGGAGGAGGGGCCGG + Intronic
1167539336 19:50075276-50075298 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167560809 19:50225841-50225863 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167560835 19:50225915-50225937 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167560877 19:50226026-50226048 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167560893 19:50226064-50226086 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167560921 19:50226138-50226160 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167560947 19:50226212-50226234 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167560989 19:50226323-50226345 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167561005 19:50226361-50226383 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167561034 19:50226435-50226457 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167561060 19:50226509-50226531 GGGTCTGAAGGAGGAGGGGCTGG + Intronic
1167561075 19:50226546-50226568 GGGTCTGAAGGAGGAGGGGCTGG + Intronic
1167561099 19:50226620-50226642 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167593124 19:50415068-50415090 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167597400 19:50434983-50435005 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167597415 19:50435020-50435042 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167597430 19:50435057-50435079 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167600443 19:50451572-50451594 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167603422 19:50467393-50467415 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167631632 19:50629588-50629610 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167631647 19:50629625-50629647 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167631663 19:50629662-50629684 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167631679 19:50629699-50629721 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167634825 19:50648613-50648635 GGGTCTGAGGGAGGAGAGGATGG - Intronic
1167662714 19:50805175-50805197 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167668847 19:50838536-50838558 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167668998 19:50839000-50839022 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167669120 19:50839402-50839424 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167669151 19:50839501-50839523 GGGTCTGAGGGAGGAGAAGCTGG + Intergenic
1167669159 19:50839537-50839559 GGGTCTGAGAGAGGAGAGGCTGG + Intergenic
1167669172 19:50839574-50839596 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167669185 19:50839611-50839633 GGGTCTGAAGGAGGAGGGGCTGG + Intergenic
1167678717 19:50906484-50906506 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167678761 19:50906594-50906616 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167678776 19:50906632-50906654 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167678786 19:50906661-50906683 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167678801 19:50906699-50906721 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167678811 19:50906728-50906750 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167678826 19:50906766-50906788 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167688142 19:50969113-50969135 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167688176 19:50969220-50969242 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167689162 19:50975001-50975023 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689177 19:50975048-50975070 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689206 19:50975128-50975150 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689226 19:50975174-50975196 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689239 19:50975214-50975236 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689255 19:50975255-50975277 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689271 19:50975296-50975318 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689286 19:50975338-50975360 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689299 19:50975378-50975400 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689316 19:50975422-50975444 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689346 19:50975506-50975528 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689360 19:50975546-50975568 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689375 19:50975586-50975608 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689388 19:50975623-50975645 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689403 19:50975663-50975685 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167689418 19:50975701-50975723 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167690104 19:50980039-50980061 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167690118 19:50980075-50980097 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167690145 19:50980148-50980170 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167690670 19:50982554-50982576 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690700 19:50982627-50982649 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690839 19:50983067-50983089 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690888 19:50983212-50983234 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690902 19:50983248-50983270 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690916 19:50983284-50983306 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690930 19:50983320-50983342 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690944 19:50983356-50983378 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690968 19:50983428-50983450 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690983 19:50983465-50983487 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167690996 19:50983502-50983524 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167691024 19:50983576-50983598 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167693638 19:51001899-51001921 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167695954 19:51015762-51015784 GGATCTGAGGGAGGACGGGCTGG - Intronic
1167705136 19:51077580-51077602 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705164 19:51077653-51077675 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705177 19:51077688-51077710 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705205 19:51077761-51077783 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705221 19:51077798-51077820 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705235 19:51077834-51077856 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705251 19:51077871-51077893 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167705266 19:51077908-51077930 GGGTCTGAGGGAGGAGGGGCTGG + Exonic
1167705514 19:51079087-51079109 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167705542 19:51079161-51079183 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167705598 19:51079339-51079361 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1167738219 19:51310458-51310480 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738234 19:51310495-51310517 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738249 19:51310532-51310554 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738277 19:51310606-51310628 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738317 19:51310717-51310739 GGCTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738345 19:51310791-51310813 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738375 19:51310865-51310887 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738390 19:51310902-51310924 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738405 19:51310939-51310961 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738421 19:51310976-51310998 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738436 19:51311013-51311035 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738451 19:51311050-51311072 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738467 19:51311087-51311109 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738482 19:51311124-51311146 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738509 19:51311196-51311218 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738539 19:51311269-51311291 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738554 19:51311306-51311328 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167738569 19:51311343-51311365 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1167741024 19:51325197-51325219 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1167741050 19:51325274-51325296 GGGTCTGAAGGAGGAAGGGCTGG + Intronic
1167743408 19:51337793-51337815 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1167746496 19:51354093-51354115 GGGTCTGACGGAGGAGGGGCTGG - Intronic
1167752799 19:51390809-51390831 GGGTCTGAGGGAGGAAGAGCTGG - Intergenic
1167752832 19:51390918-51390940 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167752846 19:51390955-51390977 GGGTCTGAGGGAGGAAGAGCTGG - Intergenic
1167795306 19:51704695-51704717 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1167795372 19:51704883-51704905 GGATCTGAGGGAGGAGGGGCTGG - Intergenic
1167798624 19:51726643-51726665 GGGTCTGAAGGAGGAGGGGCTGG - Intergenic
1167799446 19:51730572-51730594 GGGTCTGAGGGAGGAGGGGCTGG + Intergenic
1168056598 19:53868152-53868174 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168057313 19:53870387-53870409 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168057329 19:53870424-53870446 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168064235 19:53910019-53910041 GGTCCCAAAGGAGGAAAGGCTGG + Intronic
1168077699 19:53990425-53990447 GGATCTGAGGGAGGAGGGGCTGG - Intergenic
1168077728 19:53990498-53990520 GGGTCTGAGGGAGGAAGGCCTGG - Intergenic
1168077742 19:53990535-53990557 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077758 19:53990572-53990594 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077774 19:53990609-53990631 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077789 19:53990646-53990668 GGGTCTGAAGGAGGAGGGGCTGG - Intergenic
1168077828 19:53990756-53990778 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077842 19:53990792-53990814 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077856 19:53990829-53990851 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077887 19:53990903-53990925 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077902 19:53990940-53990962 GGGTCTGAAGGAGGAGGGGCTGG - Intergenic
1168077937 19:53991047-53991069 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168077950 19:53991083-53991105 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168092597 19:54095688-54095710 GGATCTGAGGGAGGAGGGGCTGG + Exonic
1168092620 19:54095762-54095784 GGGTCTGAAGGAGGAGAGGCTGG + Exonic
1168106603 19:54169371-54169393 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168106628 19:54169442-54169464 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168107078 19:54172163-54172185 GGGTCTGAGGGAGGAGGGGCCGG - Intronic
1168107204 19:54172496-54172518 GGGTCTGAGGGAGGAGGGGCCGG - Intronic
1168107731 19:54174547-54174569 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168107744 19:54174583-54174605 GGGTCTGAGGGAGGAAGGGGTGG - Intronic
1168149201 19:54435887-54435909 GGGTCTGAGGGAGGAGGGGCGGG + Intronic
1168149227 19:54435962-54435984 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168149242 19:54435998-54436020 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168155526 19:54471875-54471897 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155540 19:54471912-54471934 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155553 19:54471948-54471970 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155568 19:54471986-54472008 GGGTCTGAGGGAGGAAGGGCTGG - Intronic
1168155582 19:54472023-54472045 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155597 19:54472060-54472082 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155611 19:54472097-54472119 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155626 19:54472134-54472156 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155652 19:54472209-54472231 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155666 19:54472246-54472268 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155681 19:54472283-54472305 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155707 19:54472358-54472380 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155721 19:54472395-54472417 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155749 19:54472469-54472491 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155775 19:54472548-54472570 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155790 19:54472585-54472607 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155804 19:54472622-54472644 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155834 19:54472696-54472718 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155901 19:54472880-54472902 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155926 19:54472955-54472977 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168155940 19:54472992-54473014 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168236027 19:55063604-55063626 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168237322 19:55071535-55071557 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168237334 19:55071571-55071593 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168238155 19:55076260-55076282 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168238770 19:55078937-55078959 GGGTCTGATGGAGGAGGGGCTGG + Intronic
1168242049 19:55093277-55093299 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242064 19:55093313-55093335 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242078 19:55093349-55093371 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242090 19:55093386-55093408 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242104 19:55093422-55093444 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242116 19:55093459-55093481 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242130 19:55093495-55093517 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242142 19:55093532-55093554 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242157 19:55093568-55093590 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242169 19:55093605-55093627 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242183 19:55093641-55093663 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242198 19:55093677-55093699 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242212 19:55093713-55093735 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242227 19:55093749-55093771 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242241 19:55093785-55093807 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242255 19:55093821-55093843 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242267 19:55093858-55093880 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242281 19:55093894-55093916 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242295 19:55093930-55093952 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242310 19:55093966-55093988 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242324 19:55094002-55094024 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242336 19:55094039-55094061 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242350 19:55094075-55094097 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242365 19:55094111-55094133 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242379 19:55094147-55094169 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242391 19:55094184-55094206 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242405 19:55094220-55094242 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242420 19:55094257-55094279 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168242434 19:55094293-55094315 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168245911 19:55113168-55113190 GGCTCTGAAGGAGGAGGGGCTGG - Intronic
1168246170 19:55114078-55114100 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168250195 19:55137511-55137533 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168250222 19:55137585-55137607 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168250254 19:55137690-55137712 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168250281 19:55137763-55137785 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168250305 19:55137835-55137857 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168252193 19:55147393-55147415 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168252241 19:55147538-55147560 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1168252256 19:55147574-55147596 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168252282 19:55147657-55147679 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168252347 19:55147840-55147862 GGATCTAAGGGAGGAGAGGCTGG + Intronic
1168253602 19:55155080-55155102 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253615 19:55155116-55155138 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253628 19:55155152-55155174 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253641 19:55155188-55155210 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253654 19:55155224-55155246 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253668 19:55155260-55155282 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253694 19:55155332-55155354 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253706 19:55155368-55155390 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1168253718 19:55155404-55155426 GGGTCTCAGGGAGGAGAGGCTGG + Intronic
1168253732 19:55155440-55155462 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253746 19:55155476-55155498 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253759 19:55155512-55155534 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253772 19:55155548-55155570 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253785 19:55155584-55155606 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253810 19:55155657-55155679 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253823 19:55155693-55155715 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253837 19:55155729-55155751 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253852 19:55155766-55155788 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253866 19:55155802-55155824 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253880 19:55155838-55155860 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253906 19:55155910-55155932 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168253920 19:55155946-55155968 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168254481 19:55158092-55158114 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168254505 19:55158165-55158187 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168254518 19:55158201-55158223 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168254533 19:55158238-55158260 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168254876 19:55159756-55159778 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168254906 19:55159830-55159852 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168255304 19:55161581-55161603 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168263062 19:55207593-55207615 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263098 19:55207702-55207724 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263135 19:55207812-55207834 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263184 19:55207958-55207980 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263198 19:55207995-55208017 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263252 19:55208141-55208163 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263288 19:55208250-55208272 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263302 19:55208287-55208309 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263316 19:55208324-55208346 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263352 19:55208433-55208455 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263418 19:55208617-55208639 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263431 19:55208653-55208675 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263457 19:55208726-55208748 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263523 19:55208910-55208932 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263536 19:55208946-55208968 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168263551 19:55208983-55209005 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168266141 19:55224977-55224999 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168266181 19:55225080-55225102 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168266252 19:55225294-55225316 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168277249 19:55284797-55284819 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168277296 19:55284942-55284964 GAGTCTGAGGGAGGAGAGGCTGG + Intronic
1168277320 19:55285016-55285038 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168277378 19:55285201-55285223 GGGTCTGAGGGAGGAGGGGCAGG + Intronic
1168277389 19:55285238-55285260 GGGTCTGAAGGAGGAGGGGCTGG + Intronic
1168277568 19:55285948-55285970 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168277602 19:55286057-55286079 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168277616 19:55286094-55286116 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168277646 19:55286170-55286192 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168277672 19:55286243-55286265 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168283810 19:55320731-55320753 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168283824 19:55320769-55320791 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168283838 19:55320806-55320828 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168291587 19:55360125-55360147 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168291741 19:55360599-55360621 GGGTCTGAGGGAGGAGAGGCTGG - Intronic
1168291989 19:55361573-55361595 GGGTCTGACGGAGGAGCGGCTGG - Intronic
1168292035 19:55361713-55361735 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168292070 19:55361819-55361841 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168293661 19:55369055-55369077 GGGTCTGAGGGAGGAGAGGCTGG + Intronic
1168294731 19:55373129-55373151 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168294771 19:55373239-55373261 GGATCTGAGGGAGGAATGGCTGG - Intergenic
1168294805 19:55373348-55373370 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168294835 19:55373422-55373444 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168294863 19:55373494-55373516 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168294915 19:55373638-55373660 GGGTCTGAGGGAGGAAGGCCTGG - Intergenic
1168295219 19:55374792-55374814 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295234 19:55374829-55374851 GGGTCTGAGGGAGGAATGCCTGG - Intergenic
1168295261 19:55374921-55374943 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295276 19:55374958-55374980 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295306 19:55375034-55375056 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295339 19:55375116-55375138 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295356 19:55375155-55375177 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295371 19:55375192-55375214 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295398 19:55375267-55375289 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295413 19:55375304-55375326 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295440 19:55375377-55375399 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168295863 19:55377154-55377176 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168295878 19:55377191-55377213 GGATCTGAGGGAGGAGGGGCTGG + Intronic
1168295916 19:55377298-55377320 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168295942 19:55377367-55377389 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168306233 19:55437820-55437842 GGGTCTGATGGAGCAGGGGCTGG - Intronic
1168306280 19:55437966-55437988 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168306307 19:55438040-55438062 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168306322 19:55438077-55438099 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168306347 19:55438147-55438169 GGGTCTGAGGGAGGAGGGGCTGG - Intronic
1168310103 19:55455874-55455896 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168310116 19:55455909-55455931 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168310129 19:55455944-55455966 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168325414 19:55536372-55536394 GGGTCTGAGGGAGGAGGGGCTGG + Intronic
1168325701 19:55537429-55537451 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168325727 19:55537503-55537525 GGGTCTGAGGGAGGGAAAGCTGG - Intergenic
1168325749 19:55537576-55537598 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168325760 19:55537613-55537635 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168325784 19:55537687-55537709 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168325798 19:55537723-55537745 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168327748 19:55546749-55546771 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168327762 19:55546786-55546808 GGGTCTGAGGGAGGAAGGGCTGG - Intergenic
1168327799 19:55546896-55546918 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168327843 19:55547042-55547064 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
1168327866 19:55547116-55547138 GGGTCTGAGGAAGGAGAGGCTGG - Intergenic
1168327875 19:55547145-55547167 GGGTCTGAGGGAGGAGGGGCTGG - Intergenic
926057996 2:9787364-9787386 TGTTCTTATGGAGGGCAGGCAGG + Intergenic
926171407 2:10555120-10555142 TGTTGTGATGGAGGGGAGGCTGG + Intergenic
926977730 2:18531964-18531986 GGATCTGAGGGAGGAGAGGTGGG - Intergenic
927454511 2:23238000-23238022 GGTTCTGAAAGAGGAAAATCCGG + Intergenic
929970792 2:46573578-46573600 GTCTCTCATGGAGGAAAGTCAGG + Intronic
930933552 2:56918903-56918925 GGATCTGAGGCTGGAAAGGCTGG - Intergenic
932441224 2:71736846-71736868 GGCTTTGATGGAGGAGAGGAAGG + Intergenic
935718622 2:105960377-105960399 GGTTCTGAGGTAGGAGAGACAGG - Intergenic
937522645 2:122731378-122731400 GGTTCTAATAGAGGAGAGGAGGG - Intergenic
937672104 2:124548999-124549021 TGTTGTGATGGAGTAAAGGCTGG - Intronic
938246810 2:129783152-129783174 CTCACTGATGGAGGAAAGGCAGG - Intergenic
938697692 2:133849305-133849327 GGATATGAGGGAGGAGAGGCAGG + Intergenic
944992407 2:205253340-205253362 GGAACTGATGGAGGAAATGCTGG + Intronic
945508892 2:210675819-210675841 CTTTCTGATGGAAGAGAGGCTGG - Exonic
945568217 2:211430940-211430962 AATGCTGATGGAGGAAAGGTGGG - Exonic
946202427 2:218078396-218078418 GGCCCTGATGGAGGACGGGCAGG + Intronic
946370380 2:219278099-219278121 GGTTCTGATGGTGGGCAGCCAGG + Intronic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
948004745 2:234597780-234597802 GGTTCTGATGGAAAAGAGACAGG - Intergenic
1169850905 20:10049649-10049671 GATGGTGTTGGAGGAAAGGCAGG + Exonic
1169903172 20:10573256-10573278 GGTTTGTATGGAGGAAGGGCTGG - Intronic
1170199830 20:13730994-13731016 GGATCTGTTGGAGTCAAGGCCGG + Intronic
1170983692 20:21238921-21238943 GGGACAGATGGAGGGAAGGCAGG - Intronic
1171266006 20:23772929-23772951 GCATCTGATGGAGGCAAGGATGG + Intergenic
1172050036 20:32110146-32110168 GGTTATGATGGTGGGGAGGCGGG - Intronic
1172838974 20:37890696-37890718 GTTTCTCATGGAGGGAGGGCAGG + Intergenic
1173821333 20:46022163-46022185 GGGTCTGGTGATGGAAAGGCCGG + Intronic
1173868409 20:46327536-46327558 AGGGCCGATGGAGGAAAGGCAGG + Intergenic
1176047224 20:63099242-63099264 GGGTCTGAGGGAGGAAGGGATGG - Intergenic
1176138250 20:63534447-63534469 CGTTCTGAGGGAGGGGAGGCAGG - Intronic
1178493341 21:33067998-33068020 GGTTCTGCTGGAGGGAATTCAGG + Intergenic
1178579320 21:33824505-33824527 GGTACTGAGAGAGAAAAGGCTGG + Intronic
1180118179 21:45725849-45725871 AGACCTGATGGAGGAAAGGAAGG + Intronic
1180990648 22:19933748-19933770 TGTTCTGTGGGAGGAAGGGCTGG + Intronic
1182094694 22:27618146-27618168 GGTTATATTGGAGGAAGGGCTGG + Intergenic
1183362167 22:37388327-37388349 GGTTGTGATGGAGGAAGCACAGG - Intronic
1185292394 22:50033653-50033675 GGTTCTGTTGGGGGAGAGCCTGG - Intronic
1185414351 22:50701616-50701638 GGGTGTGATGGAGGAAAGGAGGG + Intergenic
949242603 3:1890067-1890089 GGTCCTGAGGGAGGAAAGGATGG - Intergenic
949862623 3:8520472-8520494 TGTTCTAATTTAGGAAAGGCAGG + Intronic
950192390 3:10986682-10986704 GGTTGGGCTGGAGGAAAGACAGG - Intergenic
950407485 3:12813811-12813833 AGCTCTGATGGTGGAATGGCAGG + Intronic
950427287 3:12931319-12931341 GGTGCTGATGATGGAAAGGATGG - Intronic
950601805 3:14041625-14041647 AGTCCTGAGGGAGGAAAGGGTGG + Intronic
952409649 3:33035688-33035710 GGTTCTGAGGGTGAAAATGCCGG - Intronic
952960636 3:38587208-38587230 GGTACAGAGGCAGGAAAGGCAGG - Intronic
953296137 3:41719128-41719150 GGTTATGATAGAGGAACGGCAGG - Intronic
953884289 3:46706721-46706743 GGTTTTGCAGGAGGGAAGGCTGG + Intronic
954238051 3:49272106-49272128 GGTTATGAGGGAGGAAAGGGAGG - Intronic
954425972 3:50443308-50443330 AGTTCTGATGAAAGGAAGGCAGG - Intronic
955071157 3:55573538-55573560 GGCCCTGATCAAGGAAAGGCTGG + Intronic
955935587 3:64099634-64099656 GATTTTGATGGAGGGATGGCGGG - Exonic
956437879 3:69252086-69252108 GGTTCTGATGATGCAAAGGTGGG - Intronic
957066235 3:75524825-75524847 GGTTCTGGTGGTGGGTAGGCAGG - Intergenic
960705161 3:120474600-120474622 AGTTGGGATGCAGGAAAGGCTGG + Intergenic
960707312 3:120493615-120493637 AGTCCTGATGGAGGAAAGGGTGG - Intergenic
961316779 3:126042172-126042194 AGTTCTCATGGAGGAAATGTAGG + Intronic
961364042 3:126388301-126388323 GGATCTGATGAAGCCAAGGCTGG + Intergenic
961408177 3:126698239-126698261 GGTTCTGTTGCAGGGAAGGGGGG - Intergenic
961637172 3:128340970-128340992 TGTTCTTCTGGGGGAAAGGCAGG - Intronic
962579541 3:136785295-136785317 GATTCAGATGTAAGAAAGGCAGG - Intergenic
964720487 3:159764247-159764269 GGTTGTGCGAGAGGAAAGGCGGG + Intronic
966252636 3:177883706-177883728 GGTTCTACGGGAGGTAAGGCAGG + Intergenic
966309117 3:178574222-178574244 GGTTCCCATGGAGGAAATGAGGG + Intronic
969010847 4:4060905-4060927 GGTTCTGGTGGTGGGAAGGGAGG - Intergenic
969119159 4:4894640-4894662 TTACCTGATGGAGGAAAGGCTGG - Intergenic
969212774 4:5700576-5700598 GGTTCTCATGGAGGTCAGCCTGG - Intronic
969311252 4:6354073-6354095 GGTTCAGATGGAGGAACCCCAGG - Intronic
969410307 4:7023967-7023989 GGTTCTGATGAGGGACAGCCTGG + Intronic
969562934 4:7960918-7960940 GGTTGTTTTGGAGGAAAGGCTGG - Intergenic
969571548 4:8011881-8011903 GTTTGGGAAGGAGGAAAGGCAGG - Intronic
969690229 4:8700075-8700097 GGTTCTCAGGGTGGGAAGGCTGG - Intergenic
969743220 4:9048986-9049008 GGTTCTGGTGGTGGGTAGGCAGG + Intergenic
969802600 4:9581080-9581102 GGTTCTGGTGGTGGGTAGGCAGG + Intergenic
970173064 4:13308356-13308378 GGATATGATGGAGAAAAAGCAGG - Intergenic
970808949 4:20068546-20068568 GGTTCTAATGTAGGAATGGTGGG + Intergenic
971002446 4:22338267-22338289 GGTTCTGATGAAGGAAACGGTGG - Intergenic
971732397 4:30402096-30402118 GTTTCTTTTGGAGGAATGGCTGG - Intergenic
972048783 4:34702428-34702450 GCTTCTGATGGAGGCATGGTTGG + Intergenic
972567961 4:40285822-40285844 GGTGCTGACGGAGGACAAGCCGG + Intergenic
973967726 4:56181228-56181250 GGGCCTCATCGAGGAAAGGCAGG + Intronic
974163097 4:58165756-58165778 TGTTCTGAGGAAGGCAAGGCAGG + Intergenic
974452366 4:62082636-62082658 GATTCTAATGCAGGGAAGGCTGG - Intergenic
978853038 4:113360839-113360861 GGAACGGATCGAGGAAAGGCTGG + Exonic
982288674 4:153759545-153759567 GGATCAGAAGGAGGAAAGGAAGG + Intronic
984563110 4:181293853-181293875 GTTTCTGAAGGAAGAAATGCAGG + Intergenic
985212187 4:187607086-187607108 GGTTCTTATGGAGGAGAGGCTGG + Intergenic
986463672 5:7998729-7998751 GGAGATGATGGAGGAGAGGCAGG + Intergenic
990342931 5:54842287-54842309 GGTTCAGTTTGAGGAAAGACTGG + Intergenic
992944237 5:81794034-81794056 AGTTCTGAGGGAGGAAGGTCTGG - Intergenic
997364293 5:133315762-133315784 GGTCCTGATGGTAGAAAAGCTGG - Intronic
997911133 5:137874604-137874626 GATTCTGATAGAGGATAGGGTGG - Intronic
999406852 5:151314250-151314272 CACTCAGATGGAGGAAAGGCTGG - Intergenic
999467365 5:151820547-151820569 GTTTGTGATGGGGGAAAGGATGG + Intergenic
1001284331 5:170411412-170411434 TGTTCTGACAGAGGACAGGCAGG + Intronic
1002797705 6:488138-488160 GGGACTGATGGTGGAAGGGCTGG + Intronic
1003125266 6:3351028-3351050 GCTTCTCCTGGAGGAAATGCAGG - Intronic
1003801876 6:9679069-9679091 AGTTCTGAAGGAGGAAGGGAAGG - Intronic
1004256335 6:14068126-14068148 GGCCCAGATGGAGGAAAGGAAGG + Intergenic
1004290750 6:14364666-14364688 GGTTCTGATGGTGGTGAGGCTGG + Intergenic
1004335756 6:14762943-14762965 GGGTGTGATGGAGGAAAGTGTGG - Intergenic
1005425681 6:25700363-25700385 CATTCTCATGGAGAAAAGGCTGG - Intronic
1006319977 6:33314497-33314519 GGTTCTCATGGAGGAGTGGGTGG - Exonic
1007342898 6:41203085-41203107 TGTTCTGATGGGGGAAGGGATGG - Intergenic
1007375557 6:41453761-41453783 GGCGCTGTTGGAGGAATGGCCGG - Intergenic
1007723036 6:43897148-43897170 GGTTGTGATGGAGAAGAAGCAGG - Intergenic
1007947667 6:45840539-45840561 AGGTGTGATGGAGGAAAGGTCGG - Intergenic
1011149746 6:84257867-84257889 GGTTCTGTTGGAGCAGAGGCAGG + Intergenic
1011613274 6:89174341-89174363 GGTTCTGAAGGAGGGGATGCAGG + Intergenic
1011694098 6:89896495-89896517 GGTGCAGAGGGAGGGAAGGCTGG + Intergenic
1013155861 6:107490510-107490532 GGTGCTGATGGTGGCGAGGCTGG - Exonic
1013293317 6:108737033-108737055 GGATCTGAAACAGGAAAGGCTGG + Intergenic
1013651269 6:112197265-112197287 GGTTTTTAGGGAGGAAAGACAGG + Intronic
1014559303 6:122871647-122871669 GGTACTGATAGAGGAGAGCCAGG + Intergenic
1014727611 6:124991224-124991246 GGTTCTGAGTGAGCAATGGCAGG - Intronic
1015535563 6:134264047-134264069 TGTTGTTATGGAGTAAAGGCGGG + Intronic
1017106735 6:150895101-150895123 CGTTTGGGTGGAGGAAAGGCGGG - Intronic
1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG + Intronic
1017709823 6:157157362-157157384 GGTTCTGAGTTACGAAAGGCAGG + Intronic
1018163546 6:161071584-161071606 AGTGCAGATTGAGGAAAGGCAGG + Intronic
1018934787 6:168266573-168266595 GCTTCTGGTGGAGGAAAATCCGG - Intergenic
1018944491 6:168337018-168337040 GGTGCTGGTGCAGGAAAGGATGG - Intergenic
1019772561 7:2892982-2893004 GGTTCAGATGGAGCAGAGGGTGG + Intergenic
1020035520 7:4960720-4960742 GGGGCTGATGGAGGGAAGACAGG + Intergenic
1020462475 7:8441152-8441174 CGTTCTAATTAAGGAAAGGCAGG + Intronic
1022083984 7:27048790-27048812 GGCACTGATGGAGAGAAGGCGGG - Intergenic
1023904055 7:44508702-44508724 GGATCTGAGGGAGGAGAGGAGGG - Intergenic
1023931889 7:44711264-44711286 GTTTCTGCTGGAGGAAAGGGAGG - Intergenic
1024205026 7:47150834-47150856 GATTAGGATGCAGGAAAGGCTGG + Intergenic
1024522143 7:50314921-50314943 GGTGTGGAAGGAGGAAAGGCAGG + Intronic
1024645378 7:51366636-51366658 GGTTGTGATGATGGAAAGTCTGG + Intergenic
1025603822 7:63024522-63024544 GGTTATAGTGGAGGAAAAGCTGG - Intergenic
1026358318 7:69579463-69579485 GATTCTGATGGGGGAAAGACTGG + Intergenic
1026952434 7:74356550-74356572 GGAGCTGATGGAGGAACTGCTGG - Exonic
1027331720 7:77103262-77103284 GGATCTGAAGAAGGCAAGGCTGG + Intergenic
1028728744 7:94120615-94120637 GGTTCTGATGGAGCAAACAATGG - Intergenic
1029070127 7:97888915-97888937 GGTTCTGGTGGTGGGTAGGCAGG - Intergenic
1029104806 7:98166157-98166179 AGTGCTGATGGAGGAAATGCAGG - Intronic
1029784051 7:102768073-102768095 GGATCTGAAGAAGGCAAGGCTGG - Intronic
1032268725 7:130385399-130385421 AGGTCTGATGGGGGAAAGCCTGG - Intronic
1032586222 7:133149366-133149388 GGCTATTATGGAGGAAAGGGTGG + Intergenic
1033411250 7:141119694-141119716 GGGTGAGATGGAGGAAAGGCTGG + Intronic
1034161991 7:149000851-149000873 GGATATGATGGAGGAAGGACAGG - Intergenic
1034258369 7:149736938-149736960 GGTCCTGATGGAAGGGAGGCTGG + Intergenic
1035370924 7:158378421-158378443 GGTTCTGAAGGGGGAACCGCAGG + Intronic
1035426801 7:158783612-158783634 AGCTCTGAGGGAGGAGAGGCAGG + Intronic
1036248428 8:7140772-7140794 GGTTCTGGTGGTGGGTAGGCAGG + Intergenic
1036252382 8:7173565-7173587 GGTTCTGGTGGTGGGTAGGCAGG - Intergenic
1036365112 8:8113895-8113917 GGTTCTGGTGGTGGGTAGGCAGG + Intergenic
1036653809 8:10662738-10662760 GACTGGGATGGAGGAAAGGCGGG - Intronic
1036688169 8:10925238-10925260 TGTTCTGGAGGAGGAAAGGAAGG + Intronic
1036885813 8:12552202-12552224 GGTTCTGGTGGTGGGTAGGCAGG - Intergenic
1036893433 8:12611271-12611293 GGTTCTGGTGGTGGGTAGGCAGG - Intergenic
1038660205 8:29490632-29490654 AGCCCTGTTGGAGGAAAGGCAGG + Intergenic
1038694850 8:29797479-29797501 GGTTGTGTTGGGGGAAGGGCTGG - Intergenic
1039989347 8:42474957-42474979 GGTTCTCATGGTGGGAAGGAGGG + Intronic
1041301272 8:56414402-56414424 GGGTCTGAAGGAGCAGAGGCAGG + Intergenic
1042567524 8:70127559-70127581 GGTGGAGAGGGAGGAAAGGCAGG + Intronic
1045333667 8:101179467-101179489 GATTCTGAGGGAGGTTAGGCTGG - Intronic
1046563887 8:115873847-115873869 TGTCCTAATGGAGGAATGGCAGG + Intergenic
1047241525 8:123093993-123094015 GGTTCTGATGGAGGAAAGGCTGG - Intronic
1047726307 8:127686961-127686983 GCTTCTGGTGGAGGAGAGGATGG - Intergenic
1050781046 9:9336456-9336478 GGTGATGATGGTGGACAGGCTGG + Intronic
1051588263 9:18749603-18749625 GTTTCTGAGAGAGGAAATGCAGG - Intronic
1051827206 9:21233789-21233811 GATTCTCAGGGAAGAAAGGCTGG - Intronic
1051901362 9:22045621-22045643 GGTGCTGATGGAGGAAGTGGTGG + Intergenic
1053226653 9:36364160-36364182 GTCTCTGGTGGAGGAGAGGCAGG - Intronic
1053504482 9:38629897-38629919 GGTCCTGGTGGAAGAAAGCCTGG - Intergenic
1056456565 9:86766319-86766341 GCTTCTGTGGGATGAAAGGCTGG + Intergenic
1057151936 9:92803784-92803806 GGTCCTGGTGGAAGAAAGCCCGG + Intergenic
1057310334 9:93938978-93939000 GGAGCTGATGGAGGCAGGGCTGG + Intergenic
1059289723 9:113212081-113212103 GGTTCTGTTAGATGAAAGGATGG - Intronic
1059368390 9:113805344-113805366 GGTGATGGTGGAGGAGAGGCAGG - Intergenic
1060224787 9:121784149-121784171 GATGCTGGTGGAGGAAGGGCTGG + Exonic
1061273453 9:129556960-129556982 GGTGGTGATGGAGGTCAGGCTGG + Intergenic
1061829323 9:133280743-133280765 AGTCCTGAGGGAGGAAAGGGTGG + Intergenic
1062410361 9:136421073-136421095 GGTTCTGAGGGAGGCAGTGCGGG - Intronic
1185825163 X:3242684-3242706 GGTTCTTATAGAAGGAAGGCAGG + Intergenic
1187711451 X:22058528-22058550 GGTTCTGAAAGAGGCAAGGCTGG + Intronic
1194418578 X:93644371-93644393 GTTTCTGCTGAAGGAAATGCTGG + Intergenic
1194795337 X:98204660-98204682 GGTTGTAATGTATGAAAGGCAGG + Intergenic
1195063264 X:101216936-101216958 GAATCTGAGGGGGGAAAGGCTGG - Intergenic
1195732852 X:107982810-107982832 GGAGCTAAGGGAGGAAAGGCAGG - Intergenic
1196355498 X:114787586-114787608 GGTTCTAATGGTTGAAAGCCAGG + Intronic
1196539978 X:116896296-116896318 GTTTCTGAAGGAGGAAAGAGTGG + Intergenic
1199179052 X:144831269-144831291 GGGTCTGAGGGCGGCAAGGCAGG + Intergenic
1199517968 X:148700260-148700282 GGTCCTGTTGCAGGGAAGGCTGG - Intronic
1200802371 Y:7398488-7398510 AGTCCTGAGGGAGGAAAGGGTGG - Intergenic
1201748188 Y:17403406-17403428 ATTTCTGATGAAGGAAAGGGTGG + Intergenic