ID: 1047248268

View in Genome Browser
Species Human (GRCh38)
Location 8:123162571-123162593
Sequence AAGCCAAGTCACTCCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047248261_1047248268 29 Left 1047248261 8:123162519-123162541 CCATGTGGAGGCACATTCCACAG No data
Right 1047248268 8:123162571-123162593 AAGCCAAGTCACTCCAAACAGGG No data
1047248265_1047248268 12 Left 1047248265 8:123162536-123162558 CCACAGACACAGGACTTGGGTCT No data
Right 1047248268 8:123162571-123162593 AAGCCAAGTCACTCCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047248268 Original CRISPR AAGCCAAGTCACTCCAAACA GGG Intergenic
No off target data available for this crispr