ID: 1047254598

View in Genome Browser
Species Human (GRCh38)
Location 8:123206222-123206244
Sequence GGCCCCAGGCCTCTCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047254593_1047254598 -3 Left 1047254593 8:123206202-123206224 CCCTAAAACCTGTAAGTGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG No data
1047254590_1047254598 16 Left 1047254590 8:123206183-123206205 CCTTAGGCATTTTGTTTTTCCCT 0: 1
1: 0
2: 4
3: 32
4: 487
Right 1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG No data
1047254594_1047254598 -4 Left 1047254594 8:123206203-123206225 CCTAAAACCTGTAAGTGGTGGCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047254598 Original CRISPR GGCCCCAGGCCTCTCCTTGA GGG Intronic
No off target data available for this crispr