ID: 1047254660

View in Genome Browser
Species Human (GRCh38)
Location 8:123206504-123206526
Sequence CTCCACCTGTGGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 309}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047254660_1047254674 28 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254674 8:123206555-123206577 ACCCTAAGCGCAGACTCTGGGGG No data
1047254660_1047254665 -8 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254665 8:123206519-123206541 AGGTGGAGACGAGAAGGCCCCGG No data
1047254660_1047254666 -1 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254666 8:123206526-123206548 GACGAGAAGGCCCCGGCTGCTGG No data
1047254660_1047254671 25 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254671 8:123206552-123206574 ACTACCCTAAGCGCAGACTCTGG No data
1047254660_1047254672 26 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254672 8:123206553-123206575 CTACCCTAAGCGCAGACTCTGGG No data
1047254660_1047254673 27 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254673 8:123206554-123206576 TACCCTAAGCGCAGACTCTGGGG No data
1047254660_1047254667 0 Left 1047254660 8:123206504-123206526 CCCTCCACATTCCACAGGTGGAG 0: 1
1: 0
2: 4
3: 25
4: 309
Right 1047254667 8:123206527-123206549 ACGAGAAGGCCCCGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047254660 Original CRISPR CTCCACCTGTGGAATGTGGA GGG (reversed) Intronic
900601322 1:3504023-3504045 CTCCATCTGGGGAATGAGAAGGG - Intronic
902744804 1:18466613-18466635 GGCCACCTCTGGAAGGTGGAGGG - Intergenic
902876674 1:19344624-19344646 CCCTGCCTGTGGACTGTGGATGG - Intronic
903536400 1:24069398-24069420 CTCCATCTGTGCAATGGGGCTGG - Intronic
903562221 1:24236551-24236573 CTCCACCCTAGGAATGTGAAGGG - Intergenic
909764950 1:79343632-79343654 CTTCACCTGTGGAATATATAAGG + Intergenic
910213084 1:84813916-84813938 CTCCTGCTGAGGACTGTGGAGGG + Exonic
910349239 1:86277263-86277285 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
912140816 1:106724437-106724459 CTCCACTTGAGGAATGTAGAAGG + Intergenic
912152812 1:106880488-106880510 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
912242711 1:107927688-107927710 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
912601180 1:110934602-110934624 CTCCGCCTTTGGAAAGGGGAAGG + Intergenic
913011215 1:114685592-114685614 CTCCTCCTGTGAAAGCTGGAGGG - Intronic
916476357 1:165173204-165173226 GTCCATCTGTTGAATGTGGATGG + Intergenic
919124818 1:193381191-193381213 GTCCCCTTGTGGAAGGTGGAAGG - Intergenic
919470045 1:197967105-197967127 TTCCACCTGTGGAACATGAAAGG - Intergenic
920880020 1:209871376-209871398 TTCCACCTAAAGAATGTGGATGG - Intergenic
922950757 1:229557247-229557269 CTGCACCTGTGGGCTGTGGAAGG - Intronic
924058191 1:240144108-240144130 CTGCTGCTGTGGGATGTGGATGG - Intronic
1062836279 10:637993-638015 CTCCACCAGGGAAACGTGGAAGG + Intronic
1064929917 10:20613745-20613767 CTCCACTGGTGGAAGGTTGAAGG + Intergenic
1069283344 10:66682939-66682961 CACAACCTGTGAAATGAGGAGGG - Intronic
1069343550 10:67440248-67440270 CTCCGCCTGTGGAAAGTGGAGGG + Intronic
1069822630 10:71236974-71236996 CTCCACGGCTGGGATGTGGAAGG + Intronic
1071457310 10:85860919-85860941 ACCCACCTGTGGAATGCAGATGG + Intronic
1071521380 10:86333151-86333173 CTCCATCTGTGGGGTGTGCAGGG - Intronic
1072449457 10:95528201-95528223 CCCCACCTGGGTAATGTCGAGGG + Intronic
1072574918 10:96690682-96690704 CACCACTTGGTGAATGTGGAGGG - Intronic
1072788287 10:98299585-98299607 CTCCACCTCTGGAGGCTGGAGGG + Intergenic
1073193035 10:101665798-101665820 CTCCTCCTCTGGAATGTGTTAGG - Intronic
1074579531 10:114705464-114705486 CTCAAACAGTGGAATCTGGAGGG + Intergenic
1075553275 10:123409836-123409858 CTGCACCTGTGGGATCTTGAAGG + Intergenic
1075585731 10:123656753-123656775 CTCCACCTGCGAAATGAGGTGGG - Intergenic
1076296025 10:129385515-129385537 TTGGACATGTGGAATGTGGATGG + Intergenic
1078091348 11:8266472-8266494 CATCACCTGTGGAATGTGTTGGG - Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079473838 11:20807784-20807806 CTCCACCTGGGAAAAGGGGAAGG - Intronic
1083050863 11:59775308-59775330 CTCCAATTGTGGATCGTGGAAGG + Intronic
1083275884 11:61596876-61596898 CTCCACCTGTAAAATGGAGATGG - Intergenic
1083869838 11:65479921-65479943 CTCTCCCTGTGGAAGGTGGGGGG + Intergenic
1084741997 11:71146081-71146103 GTCCACCTGGGGAATGTGGGTGG - Intronic
1084980322 11:72825383-72825405 ATCCACCTCTGGAATGTTGTGGG + Exonic
1085223516 11:74896430-74896452 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1085469041 11:76745169-76745191 CTCCACCTGTGGACTGCCCATGG + Intergenic
1085792341 11:79506911-79506933 CTCCCCCTGTGCAATCTGGATGG - Intergenic
1086468132 11:87076269-87076291 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1087805665 11:102552609-102552631 CTCCATTTGTGGGTTGTGGAAGG + Intergenic
1088154789 11:106790227-106790249 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1088169498 11:106979741-106979763 CTACCCCTTTGGAATGTGGGAGG - Intronic
1088859873 11:113789722-113789744 CACCACCTGTAGAAGCTGGAGGG + Intergenic
1088907017 11:114162693-114162715 CCCCACATAAGGAATGTGGAGGG - Intronic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089750843 11:120650057-120650079 TTCCACCTGTGGGATGGGAAGGG - Intronic
1094258625 12:28465119-28465141 CTCTACCTTTGGAAAGGGGAGGG + Intronic
1094380703 12:29840366-29840388 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1095977632 12:47950492-47950514 CTAGACCAGTGGAATGTGGAGGG + Intergenic
1097058752 12:56267052-56267074 CTCCGCCTTTGGAGTGAGGAGGG + Exonic
1097234363 12:57529311-57529333 CTGCACCTGTGGACAGTGGGTGG + Exonic
1097473186 12:60021378-60021400 CTCTACCTTTGGAAAGAGGAAGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1101972608 12:109326368-109326390 CTCCACATGGGGGATGAGGAAGG + Intergenic
1103042420 12:117706376-117706398 CTCCATCTGTGAAATGGGGTTGG - Intronic
1106765513 13:32909461-32909483 CTCCACCTCTTGAATCTGGAAGG - Intergenic
1107178161 13:37423506-37423528 TTCTACCTGTGGAAAGAGGAGGG + Intergenic
1107552156 13:41487338-41487360 CTCTACCTCTGGAATGGAGAGGG - Intergenic
1108140481 13:47415982-47416004 CCCCACCTGTGAAAGGGGGAGGG - Intergenic
1111531283 13:89541102-89541124 CTGCCCCTATGGAATGGGGAAGG - Intergenic
1111542769 13:89689873-89689895 CTCTGCCTGTGGAATGGGGAGGG + Intergenic
1114226307 14:20741776-20741798 CTCCACATGGGAAATATGGAGGG - Intronic
1114493032 14:23114928-23114950 ATCCACCTGGGGACTGTGTAGGG + Intergenic
1114506330 14:23217269-23217291 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1114985081 14:28217133-28217155 CTCCACTTGTGAAAATTGGAGGG - Intergenic
1115133965 14:30086738-30086760 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1116021582 14:39468618-39468640 CTCTGCCTGTGGAAAGTGGAGGG - Intergenic
1116434107 14:44877495-44877517 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116481131 14:45392406-45392428 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116497742 14:45582977-45582999 CTCTGCCTGAGGAAAGTGGAGGG - Intergenic
1116889190 14:50250399-50250421 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1117103143 14:52370812-52370834 CTCCTCCTGTGAGTTGTGGAAGG - Intergenic
1117437589 14:55731736-55731758 CTCCACCTGTGGGAGACGGAGGG + Intergenic
1119724686 14:76914856-76914878 CTCCACCTCTGGGATCTGCAGGG - Intergenic
1119726585 14:76925118-76925140 CCCCACCTGTGAAATGGGGTCGG + Intergenic
1120877797 14:89391018-89391040 CTTCACCTCTGGACTGTGGTGGG - Intronic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1124511087 15:30326508-30326530 CACCACCAGTGGAAGGTGAAGGG - Intergenic
1124731827 15:32204257-32204279 CACCACCAGTGGAAGGTGAAGGG + Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1127475759 15:59331264-59331286 GTCCACCTGTGGACTGAGCAAGG - Intronic
1127493284 15:59485026-59485048 CTCACCCTGGGGAAAGTGGAGGG + Intronic
1127971466 15:63965688-63965710 CTCCGCTTGTGGAAAGGGGAGGG - Intronic
1128488143 15:68117577-68117599 ATCCACATGTGGAATCTGAAAGG - Intronic
1128522064 15:68381958-68381980 CCCCACCTCTGGGAGGTGGATGG + Intronic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1129180401 15:73870773-73870795 CTCCACATGTGCCATGAGGATGG - Intergenic
1129615842 15:77098284-77098306 CTCCAGCTGAAGACTGTGGATGG - Intergenic
1129687121 15:77692858-77692880 CTCCACCTGTGGAATGGGGCTGG - Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1129835459 15:78702717-78702739 CTCCTCCTGTGGAATGGGGAAGG - Intronic
1130441098 15:83955253-83955275 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1130511854 15:84595884-84595906 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
1130961763 15:88664078-88664100 CTCTACTTGTGGAATGGGAAGGG + Intergenic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1132764174 16:1526072-1526094 GTCCTCCTGAGGAATGAGGATGG + Exonic
1132813688 16:1815646-1815668 TTCCACATCTGGACTGTGGAGGG + Intronic
1133331787 16:4979402-4979424 CTCCATCTGTCAAATGCGGAGGG + Intronic
1133930018 16:10224417-10224439 CCCCACCTGTGGGTTGTGGGAGG - Intergenic
1133930285 16:10226771-10226793 AGCCCCCTGTGGAATGAGGAGGG + Intergenic
1136482121 16:30548583-30548605 CTCCCCCTGTGCAGTGTGGGTGG + Intronic
1136542828 16:30937837-30937859 TTCCAGCTGTGGACCGTGGAAGG + Intronic
1136588163 16:31201318-31201340 CACCACCTGGTGAATGAGGAGGG + Intergenic
1138485644 16:57341313-57341335 TTCCATCTGTGAAATGTGCAAGG + Intergenic
1138914328 16:61444699-61444721 CACCACCTGGGGAAAGTAGAAGG + Intergenic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141625354 16:85258628-85258650 CTCCGCCTGTGGGAGGAGGAGGG + Intergenic
1141677614 16:85525808-85525830 CTACCCCTGTGGGATGTGGGTGG - Intergenic
1141736891 16:85859951-85859973 CTCCCCCTGTGGACTGAGGGTGG + Intergenic
1143270651 17:5672384-5672406 CTCCACCTGGGGCTTGTGGGTGG + Intergenic
1144761649 17:17710675-17710697 CTCCACCTCTGAAATGAGGAGGG - Intronic
1145140977 17:20448661-20448683 CTCCACCAGGGCAGTGTGGAAGG - Intergenic
1145259874 17:21348404-21348426 CTCCACCTTTGGAAAGTCGGGGG + Intergenic
1145316741 17:21739534-21739556 CTCCACCTTTGGAAAGTCGGGGG - Intergenic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1149482983 17:57018382-57018404 CTCCCCCTGTGGGGTCTGGATGG - Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1150497284 17:65617618-65617640 CTCCCACAGTGGTATGTGGAAGG + Intronic
1152294822 17:79460773-79460795 CTCCCACGGTGGAAAGTGGAAGG - Intronic
1155238708 18:23846093-23846115 CTCCTCCTGTGGCAGGTGGTAGG + Intronic
1158067496 18:53429690-53429712 TTCCACCTGTGGAAAGTCTAAGG - Intronic
1158402080 18:57130180-57130202 CTCAGGCTTTGGAATGTGGAAGG + Intergenic
1159080685 18:63731842-63731864 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1160838754 19:1136977-1136999 CAGCACCTGGGGAATGGGGATGG + Intronic
1161895953 19:7080474-7080496 CTACACCTATGGAAGCTGGAGGG - Intronic
1161967099 19:7554876-7554898 CTCCAGCTGCGGAATACGGACGG - Exonic
1162692965 19:12449198-12449220 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1164586317 19:29478278-29478300 CTCTACCTGTGGCCTTTGGAGGG + Intergenic
1165365482 19:35362547-35362569 CTCCTCCTGGGGAGTGTGGTGGG - Intergenic
1165645474 19:37431940-37431962 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1167550593 19:50157979-50158001 CTATACCTGGGGAATTTGGAAGG - Intronic
1168413573 19:56155244-56155266 CTCCTGCCGTGGAGTGTGGACGG + Intronic
1168615383 19:57833280-57833302 CTCTGCCTGTGGAAAGGGGATGG - Intronic
1168621401 19:57882167-57882189 CTCTGCCTGTGGAAAGGGGATGG + Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
926572726 2:14547086-14547108 TTCCACCTATGGATTGGGGAGGG + Intergenic
927083206 2:19650618-19650640 TTCCACATGTGGAGTGTGAAAGG + Intergenic
928293601 2:30061540-30061562 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
929449593 2:42027903-42027925 CTGCATCTGTGGAATCGGGAGGG - Intergenic
929449686 2:42028360-42028382 CTCCATCTCTGGAAAATGGAGGG + Intergenic
929524970 2:42693474-42693496 CTCTGCCTGTGGAAAGGGGAAGG - Intronic
929774258 2:44918384-44918406 CCCCACCTCTGGAATCTGGACGG + Intergenic
930439619 2:51390166-51390188 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
931400349 2:61925524-61925546 CTCCCCCTGTGGGGTCTGGATGG + Intronic
931418897 2:62107427-62107449 CTCCACTTGGTGAATATGGATGG + Intronic
931710934 2:64988950-64988972 CTCCTCCTGAGGACTGTGGGAGG - Intronic
935376236 2:102400379-102400401 CTCTAGTTGTGGTATGTGGAGGG - Intergenic
935532735 2:104254250-104254272 CTCCACCTTTGGAAAGGTGAGGG + Intergenic
935902547 2:107808092-107808114 TTCCATCTGTGGCCTGTGGATGG + Intergenic
936024723 2:109022325-109022347 CTCCCCCTGGGGAAGGTAGATGG - Intergenic
937379496 2:121363741-121363763 CTCCACCTAAGGACAGTGGAAGG + Intronic
937429468 2:121826208-121826230 CTCCATCTCTGGGATGTGGGTGG - Intergenic
937434812 2:121871557-121871579 CTCAGCCTCTGGAATGTGAAAGG - Intergenic
938132845 2:128732203-128732225 CTCCATCTGTGGGGTGTGGAGGG - Intergenic
940329474 2:152458522-152458544 CTCCAAATGTGGAGTGAGGATGG - Intronic
941672521 2:168310339-168310361 CTCTGCCTGTGGAAAGGGGAAGG - Intergenic
944095882 2:195967949-195967971 TTCCACTTGTGGAAAGAGGAGGG - Intronic
944192047 2:197013762-197013784 CCCCTCCTGTGGACTGTGGCGGG - Intronic
944444880 2:199779509-199779531 GTGCACATGTGGAAGGTGGAGGG - Intronic
947687068 2:232097477-232097499 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
947998436 2:234547899-234547921 TACCTCCTGTGGAAGGTGGAAGG - Intergenic
948467775 2:238160353-238160375 CTGCACCTGTGGCCTGTGGCCGG - Intronic
948726166 2:239935325-239935347 ATCCACTTTTGTAATGTGGATGG + Intronic
1169205935 20:3740401-3740423 CTCCACCTTTTGAAGGAGGAGGG + Intronic
1169811156 20:9610772-9610794 CCCAACCTGTGAAATGTGGAGGG - Intronic
1170585866 20:17733296-17733318 CTCCACCTGGGGAATGGGAGGGG + Intronic
1170668455 20:18406965-18406987 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1171201170 20:23243584-23243606 CTCCACATGGGGACTGTGGTGGG + Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1174536340 20:51254312-51254334 TTACACCTGTGGGAAGTGGAAGG + Intergenic
1177212896 21:18091860-18091882 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
1177479983 21:21674319-21674341 CACCACCTAGGGAATGTGGGTGG - Intergenic
1177487945 21:21783269-21783291 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1183710309 22:39499518-39499540 CTCCACCTGTGTATTGGAGATGG - Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
951102370 3:18703660-18703682 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
952157311 3:30657186-30657208 CACCACCACGGGAATGTGGAAGG - Intronic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
954224023 3:49171475-49171497 CTCCAGCTGCGGCATGTGCAGGG + Intergenic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955086216 3:55705498-55705520 ATCAACCTGTGGCATTTGGAAGG + Intronic
955809281 3:62769633-62769655 CTCCACCTGGGGAGTCTGGAAGG - Intronic
959336137 3:105067063-105067085 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
960948327 3:122982189-122982211 CTCCACATGGGAAATGAGGAAGG - Intronic
961418954 3:126784490-126784512 CCCCAACTGTGGAATGTGGCTGG + Intronic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961964372 3:130887565-130887587 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
962106893 3:132399503-132399525 GACCACCTGTGGACTGTAGATGG - Intergenic
962740002 3:138356725-138356747 CTCAACCTGAGGAATGTGGGTGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963310147 3:143700574-143700596 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964339043 3:155688805-155688827 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964694089 3:159487477-159487499 CTCCAACTGTGAAATGTGGGTGG - Intronic
966400990 3:179546732-179546754 CTCCACCTGGGGAAAGGGGAGGG + Intergenic
966493128 3:180551176-180551198 CTCCACTTGTTCAAAGTGGATGG - Intergenic
967788415 3:193521992-193522014 GTCCACCTGCTGACTGTGGAGGG - Intronic
968232243 3:197010909-197010931 CTTCCCCTGGGGAATGTGGGTGG + Intronic
968838507 4:2982572-2982594 TTCCACTTGTGGAATCTAGAGGG + Intronic
971095613 4:23399070-23399092 CTCTGCCTGTGGAAAGGGGACGG - Intergenic
972406078 4:38747832-38747854 CTCCACTAGGGCAATGTGGAGGG + Intergenic
973820366 4:54657671-54657693 TTCCACCCCTGGGATGTGGACGG - Intergenic
974419740 4:61658114-61658136 CTCCAGCTTTGGAATATGAATGG - Intronic
976069500 4:81224947-81224969 CACAACCTAAGGAATGTGGATGG - Intergenic
977499512 4:97821556-97821578 CTCTACTAGTGCAATGTGGAGGG - Intronic
979573050 4:122252561-122252583 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
981190502 4:141856858-141856880 GATCACCTGTGAAATGTGGATGG - Intergenic
981870992 4:149486375-149486397 CTCTGCCTGTGGAAACTGGAGGG - Intergenic
982899473 4:160980549-160980571 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
984651100 4:182271430-182271452 CTCCACCTATGCATGGTGGAAGG - Intronic
985446880 4:190026991-190027013 CTGCTCCTGTGGAGTCTGGAAGG - Intronic
985945123 5:3176206-3176228 CTCCAGATCTGAAATGTGGAAGG + Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
986756376 5:10840130-10840152 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
988340174 5:29960537-29960559 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG + Intronic
989504781 5:42215236-42215258 CTCTGCCTTTGGAAAGTGGAGGG - Intergenic
991237813 5:64419298-64419320 CTCTACCTGTGGAAAGGGGACGG + Intergenic
991313164 5:65268741-65268763 CTCCATCTGTTAAATGTGCATGG + Intronic
993287298 5:86016092-86016114 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
993456289 5:88131101-88131123 CTCTACTAGTGCAATGTGGAGGG - Intergenic
993981315 5:94546126-94546148 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
994028620 5:95114562-95114584 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
994798337 5:104335919-104335941 TTCCACCTGTAAAATGTGGGGGG + Intergenic
995770665 5:115665627-115665649 CTCTACCTGTGGAAAGGGAAGGG + Intergenic
996463465 5:123772972-123772994 CTCCACCTGTGGTTAGGGGAGGG + Intergenic
996666619 5:126066989-126067011 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
997869130 5:137491446-137491468 CCACACCTGTGGCAAGTGGAGGG - Intronic
998291140 5:140916028-140916050 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998528088 5:142860808-142860830 CTCCACCTTTGTCATCTGGAGGG + Intronic
999508118 5:152219360-152219382 CTCCACCTGTGCAATGGGACAGG + Intergenic
1000069778 5:157729555-157729577 CTCCCAGTGTGGGATGTGGATGG + Intergenic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1006812265 6:36827525-36827547 CTCAACATGTGGTATTTGGACGG - Intronic
1009771178 6:68144815-68144837 CTCTGCCTTTGGAATGGGGAGGG - Intergenic
1009893841 6:69721968-69721990 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1010176390 6:73032899-73032921 CTTCACCTGTGGCAGGTGAAGGG + Intronic
1010325116 6:74555135-74555157 CTCTACCTTTGGAAAGGGGAGGG + Intergenic
1010502252 6:76615318-76615340 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1010676716 6:78753950-78753972 CTCTGCCTGTGGAAAGGGGATGG + Intergenic
1012224552 6:96689053-96689075 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1013687510 6:112601941-112601963 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
1013908606 6:115246990-115247012 CTCTACTTGTGGAAAGGGGAGGG + Intergenic
1013925571 6:115468027-115468049 CTCCGCCTTTGGAAAGAGGAGGG - Intergenic
1013947250 6:115736104-115736126 CTCCACTAGTGCAGTGTGGAAGG + Intergenic
1014865194 6:126520994-126521016 CTCTGCCTTTGGAAAGTGGATGG - Intergenic
1017868311 6:158464323-158464345 ATCCACCTGTGACATGTGTATGG - Intronic
1018800613 6:167219339-167219361 CTCCACCTGGGGCATGTGAGTGG + Intergenic
1019079458 6:169420387-169420409 CTCCACCTGTGGGATGGGTGCGG + Intergenic
1019401899 7:859561-859583 GTCCACACGTGGAATGTGGGAGG + Intronic
1020812711 7:12865185-12865207 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1021214542 7:17900548-17900570 CTCTACTTGTGGAAAGGGGAGGG - Intronic
1022080259 7:27012956-27012978 CTCCTCCTTTGGAAAGGGGAAGG + Intergenic
1023299554 7:38755012-38755034 TTCCACCTGTGAACTGTGGTAGG - Intronic
1023931521 7:44709160-44709182 CTCCCCCTGTCCAATGAGGAGGG - Intergenic
1024244106 7:47456414-47456436 CCCCACCTGGGGAATGGGGGTGG + Intronic
1024713115 7:52040242-52040264 CTCCACCAGGGGAATGAGGAGGG - Intergenic
1026460191 7:70607899-70607921 CTGCACATGTGGAATGTTGGTGG + Intronic
1026985868 7:74555009-74555031 CCCCACATGTGGAATCTGGGGGG - Intronic
1028001422 7:85502369-85502391 CTCTGCCTTTGGAATGGGGAGGG + Intergenic
1032800529 7:135314060-135314082 CTCCCCCTCTAGAATCTGGAGGG + Intergenic
1033014475 7:137658356-137658378 CACCACCTGTGGAAAATGCATGG + Intronic
1033049825 7:137994085-137994107 CTGCCCCTGTGGAATCAGGATGG - Intronic
1035561620 8:608427-608449 GTCCACCTGTGGGTTGTGCATGG + Intergenic
1037294137 8:17383076-17383098 CACCACCTGGGGGGTGTGGAAGG + Intronic
1037905551 8:22714092-22714114 CTCCACCTCTGCCATGGGGAAGG - Intronic
1037973578 8:23192420-23192442 CTGCATCTGTGGAAAGTGCAGGG + Intronic
1038078588 8:24106061-24106083 CTTGACCTGTGGAACTTGGAAGG + Intergenic
1039630371 8:39106159-39106181 CTCCATCTGGGGCAGGTGGAGGG - Intergenic
1041923801 8:63215010-63215032 CTCCTCCTTTGGAATTTGGCTGG + Intergenic
1042898431 8:73695778-73695800 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1043998067 8:86843454-86843476 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1044011432 8:86998823-86998845 ATCTACCTGTAAAATGTGGATGG - Intronic
1045207147 8:100054913-100054935 CTCCACCTTTGGAAAGTGGAAGG + Intronic
1045998819 8:108395528-108395550 CTGGATCTGTGGAATGGGGATGG - Intronic
1046384053 8:113486249-113486271 CTCTCCCTGTGGAAAGAGGAGGG - Intergenic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047933695 8:129753907-129753929 CTCTACCTGTGAAAAGGGGAGGG + Intronic
1048014527 8:130485632-130485654 CTCCACAGGTGGGATATGGAGGG - Intergenic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1048354878 8:133645243-133645265 CCCCACCCATGGAAGGTGGAAGG + Intergenic
1050339577 9:4622262-4622284 CTCCAGCTGTGGAATTTCCAGGG - Intronic
1050649567 9:7760736-7760758 CTACATCTGTAGTATGTGGAAGG + Intergenic
1051921814 9:22275329-22275351 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1052032155 9:23640959-23640981 CTGCACTTGGGGAATGGGGAAGG - Intergenic
1052361971 9:27571818-27571840 CTCCTGTTGTGGAAAGTGGACGG - Intronic
1055692244 9:78845644-78845666 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1058733552 9:107873645-107873667 CTCCAACTAAGGAATGTTGATGG - Intergenic
1058781266 9:108337801-108337823 TTACACCAGTGGAATGTGGCAGG + Intergenic
1059938430 9:119334652-119334674 CTGCACCTGTGCAACGAGGAAGG + Intronic
1059972243 9:119679641-119679663 ATCCATCTGTGAAATGAGGATGG + Intergenic
1061251027 9:129426461-129426483 CTGCACCTGTGGAGTGAGCAAGG - Intergenic
1061462249 9:130749652-130749674 CTCCATCTGTTGAATGAGGCTGG + Intronic
1061841958 9:133363943-133363965 CACCAGCTTTGAAATGTGGAAGG + Intronic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186169532 X:6862069-6862091 CTCCATCTGTGGAAGGTGCCTGG - Intergenic
1186276095 X:7939665-7939687 CTCCACCTGCTGAGTGAGGAAGG + Intergenic
1187618156 X:21020771-21020793 CTCCACCTGTGGAAAGGAGAGGG + Intergenic
1188157649 X:26759701-26759723 CTCCATATGTGGAATTTGAAAGG - Intergenic
1189411828 X:40779539-40779561 CTCTGCTTGTGGAAAGTGGAGGG - Intergenic
1189593904 X:42543877-42543899 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190015179 X:46820272-46820294 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190197043 X:48328707-48328729 CGTCATCTGGGGAATGTGGAGGG + Intergenic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1191718117 X:64206542-64206564 CACCTTCTATGGAATGTGGAGGG + Intergenic
1192640766 X:72859745-72859767 CTCTTCCTGTGGAAAGGGGAGGG + Intergenic
1192640945 X:72861031-72861053 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
1193252597 X:79309454-79309476 CTCCCCCTTTGGAAAGAGGAAGG + Intergenic
1193564119 X:83056378-83056400 CTCTACCAGGGCAATGTGGAGGG - Intergenic
1194327652 X:92540294-92540316 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1194338652 X:92682049-92682071 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1195294883 X:103466235-103466257 CTCCACCTGAGGAATCTAAATGG - Intergenic
1196181145 X:112691035-112691057 CTCCACCTGTTGACTCTGCATGG + Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1198454896 X:136807089-136807111 CTCCATCTGTGGGATGCTGAAGG - Intergenic
1199393730 X:147309966-147309988 TTCTGCCTGTGAAATGTGGAGGG + Intergenic
1199485156 X:148338805-148338827 CTCTACCTGTGGAAACGGGAGGG + Intergenic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1200039692 X:153356060-153356082 CCCCACCTGAGGAAGGTGGAGGG + Intronic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1200636363 Y:5659512-5659534 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1200647043 Y:5798831-5798853 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic