ID: 1047254838

View in Genome Browser
Species Human (GRCh38)
Location 8:123207149-123207171
Sequence CAGAGCCAGGTGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047254838_1047254845 16 Left 1047254838 8:123207149-123207171 CCCTCCAGCTTCACCTGGCTCTG 0: 1
1: 1
2: 1
3: 41
4: 406
Right 1047254845 8:123207188-123207210 AACATCCTCTCCAAGTTCACAGG 0: 1
1: 0
2: 2
3: 22
4: 194
1047254838_1047254847 21 Left 1047254838 8:123207149-123207171 CCCTCCAGCTTCACCTGGCTCTG 0: 1
1: 1
2: 1
3: 41
4: 406
Right 1047254847 8:123207193-123207215 CCTCTCCAAGTTCACAGGCCAGG 0: 1
1: 1
2: 0
3: 23
4: 256
1047254838_1047254843 -7 Left 1047254838 8:123207149-123207171 CCCTCCAGCTTCACCTGGCTCTG 0: 1
1: 1
2: 1
3: 41
4: 406
Right 1047254843 8:123207165-123207187 GGCTCTGCGGACACGTGCACCGG 0: 1
1: 0
2: 0
3: 6
4: 87
1047254838_1047254848 24 Left 1047254838 8:123207149-123207171 CCCTCCAGCTTCACCTGGCTCTG 0: 1
1: 1
2: 1
3: 41
4: 406
Right 1047254848 8:123207196-123207218 CTCCAAGTTCACAGGCCAGGCGG 0: 1
1: 0
2: 3
3: 38
4: 247
1047254838_1047254850 27 Left 1047254838 8:123207149-123207171 CCCTCCAGCTTCACCTGGCTCTG 0: 1
1: 1
2: 1
3: 41
4: 406
Right 1047254850 8:123207199-123207221 CAAGTTCACAGGCCAGGCGGTGG 0: 1
1: 0
2: 1
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047254838 Original CRISPR CAGAGCCAGGTGAAGCTGGA GGG (reversed) Exonic
900302576 1:1985545-1985567 GAGTGCCAGGTGAACCTGGATGG - Intronic
900413437 1:2524086-2524108 CAGAGGCAGGTGAGACAGGAAGG - Intronic
900484898 1:2917853-2917875 CAGAGCCTGCAGAAGCTGGAAGG - Intergenic
900503516 1:3017989-3018011 CAGAGCCAGAAGAAGCAGGAAGG - Intergenic
902065608 1:13683301-13683323 TAAAGGCAGATGAAGCTGGAAGG + Intergenic
902692468 1:18118386-18118408 CAGAGGCTGGGGCAGCTGGAGGG + Intronic
902828227 1:18992089-18992111 CAAGGGCAGCTGAAGCTGGAAGG - Intergenic
902839808 1:19067578-19067600 CAGGGCCAGGTGAAGAAGCAGGG + Intergenic
903045679 1:20562702-20562724 CAGAGCCACGTGCTGATGGAAGG - Intergenic
903058246 1:20651762-20651784 CGGGGCCAGGTGAAGTTTGAGGG + Exonic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904755867 1:32768261-32768283 CAGTGCTAGGTGATGCTGGAGGG + Intronic
906671095 1:47655640-47655662 CAGGGCCAGGGCAGGCTGGATGG - Intergenic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907443338 1:54491509-54491531 TAGAGAGAGATGAAGCTGGAGGG + Intergenic
909409153 1:75328964-75328986 CAGAGCCACTTGAAAATGGAGGG + Intronic
912679724 1:111721394-111721416 CAGAGCCAGGTCATGGTGGGTGG + Intronic
912703693 1:111896700-111896722 CAGTGTCAGGCCAAGCTGGAAGG + Intronic
913077122 1:115350059-115350081 CAGAGCCATCAGCAGCTGGAGGG - Intergenic
913188045 1:116388123-116388145 CACACCCAGGTACAGCTGGAAGG - Exonic
915604098 1:156940007-156940029 CAGGCACAGGTGAAGCTGGAGGG + Intronic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917210682 1:172628940-172628962 CAGGCCCAGGTAAAGCAGGAGGG - Intergenic
919981749 1:202646218-202646240 CAGTGCCAGGTGAAGCTGGAAGG - Intronic
920033160 1:203049278-203049300 CAGAGCCTGGTGATTCTGGGAGG + Intronic
920034714 1:203058431-203058453 CACAGACAGGGGAAGCTGAACGG + Intronic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
920857534 1:209675310-209675332 CAGAGCCAGGGGAACTCGGAGGG - Intergenic
922323779 1:224510219-224510241 CAGAGGTAGAAGAAGCTGGAGGG + Intronic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922598594 1:226833040-226833062 AAGAGCAAGGTGAGGCTGGGTGG + Intergenic
922666310 1:227472445-227472467 GAGAGATAGGTGATGCTGGAGGG + Intergenic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923261508 1:232272341-232272363 CAGAGCCAGGCCAAGCAGGTGGG - Intergenic
924030870 1:239884358-239884380 CAGAGCCACTAGAAACTGGAAGG + Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063086433 10:2822452-2822474 CAGAGCCATGTGATGCAGGGTGG - Intergenic
1064059147 10:12122786-12122808 CTGAGTCAGGTGAAGCTACATGG - Exonic
1064559679 10:16583855-16583877 CAGAAACAGGAGAAGCTGAAAGG - Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067152199 10:43745964-43745986 CAGATCCAGGTGAAACTTGCAGG + Intergenic
1068942108 10:62690391-62690413 CTGAGCCAGGTGTGGCTGGGAGG - Intergenic
1069183996 10:65399593-65399615 CAGAGGCAGGAGCAGCTAGAGGG - Intergenic
1069716159 10:70522817-70522839 CAGATCCCCCTGAAGCTGGAAGG + Intronic
1069770638 10:70897190-70897212 CTGGGCCATGTGAAGCTGTAGGG + Intergenic
1070326869 10:75395460-75395482 CAGAGCCCGGCGGAGCAGGAAGG - Intergenic
1074681196 10:115909476-115909498 CAATGGAAGGTGAAGCTGGAAGG - Intronic
1074803673 10:117027006-117027028 CTGAGCCACCTGGAGCTGGAGGG - Intronic
1075427031 10:122350033-122350055 CAGAGCCAGGTGAGGCCCAAAGG + Intergenic
1075986075 10:126786520-126786542 CAGAGCCACATGCAGCTGGCGGG + Intergenic
1076124004 10:127960541-127960563 GAGAACCAGGTAAAGCTGCAGGG - Intronic
1076237829 10:128879536-128879558 AAGAGGAAGGTGAGGCTGGAAGG + Intergenic
1076679641 10:132165105-132165127 CAGTGCAAGGTGAACCTGCACGG - Intronic
1076781246 10:132725816-132725838 CAGAGCCAGGTGGGGCTGCCAGG - Intronic
1076887920 10:133271057-133271079 CTGGGCCAGGTGAAGCCGGCTGG - Exonic
1077106353 11:844146-844168 CAGAGCCAGGTTCAGCTGCGAGG + Intronic
1077161388 11:1114162-1114184 CAGAGCCACCTGCAGCTGGAAGG - Intergenic
1077221881 11:1421587-1421609 CAGTGCCAGGTGCAGAGGGAAGG - Intronic
1077308846 11:1879692-1879714 TAGACCCAGGTGACCCTGGAGGG - Intronic
1077481045 11:2814779-2814801 CAGAGGCAGATGGAGCAGGAGGG - Intronic
1078706551 11:13749199-13749221 GAGAACCAGGGCAAGCTGGAGGG + Intergenic
1079240364 11:18718164-18718186 CAGCGCCAGCCTAAGCTGGAGGG + Intronic
1081588824 11:44406860-44406882 CAGTGCGAGGTGGGGCTGGAAGG + Intergenic
1082785304 11:57313354-57313376 CAGGACCAGGAGAAGCTGGGGGG - Exonic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083960445 11:66012276-66012298 CAGAGCCAGGTGCGGCGGGCGGG + Exonic
1084075558 11:66772678-66772700 CAGAATCAGCTGAACCTGGAAGG + Intronic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1084858980 11:72005902-72005924 GAGGGGCAGGTGGAGCTGGATGG + Intronic
1085017720 11:73186118-73186140 CAGAGACAGGAGAAGCTGCAAGG - Intergenic
1086142234 11:83512052-83512074 GGGAGCCAGGGGAAGCTGGGTGG + Intronic
1086410633 11:86540984-86541006 GAGAGCAAGGTGAAGCAGGGTGG + Intronic
1087962230 11:104366401-104366423 CAGTGAGAGGTGAAGCTGGCTGG - Intergenic
1088789721 11:113213903-113213925 CACAGGAAGGTGAGGCTGGATGG - Intronic
1088813502 11:113406783-113406805 CAGAGCCAGGTCCACCTGGTTGG + Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1089745348 11:120613039-120613061 AAGAGCCATTTGAGGCTGGAGGG + Intronic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090464534 11:126922552-126922574 CAGAGCCAGTGGAGGATGGAGGG - Intronic
1090923059 11:131224154-131224176 CAGGGGCAGCTGAAGCTGGGAGG + Intergenic
1090939682 11:131376049-131376071 CAGATCTAGGTCAAGCTGGCAGG + Intronic
1091088664 11:132748572-132748594 CAAAGCCTGGGGAGGCTGGAAGG + Intronic
1091908728 12:4211563-4211585 AAGAGCGTGGTGAAGCAGGAAGG - Intergenic
1096656862 12:53097587-53097609 AAGAGCCAGGTGAAGGGGGGTGG - Exonic
1097077980 12:56409294-56409316 CACAGGCAGGTGAAGCTGTGGGG + Intergenic
1098089455 12:66885462-66885484 CAAAGCCAGGAGTAGATGGAGGG + Intergenic
1098377808 12:69836259-69836281 CAGAGACAGAAGCAGCTGGAGGG - Intronic
1099015584 12:77339936-77339958 TAGAGCATGATGAAGCTGGAAGG + Intergenic
1101446828 12:104742685-104742707 CCAGGCCAGGTGCAGCTGGAAGG - Intronic
1102201113 12:111058614-111058636 CAGATACAGGAGAAGCTGGAGGG + Intronic
1102473422 12:113173483-113173505 CAGACCCAGGTGTAGCTGACAGG + Intronic
1102596577 12:113997350-113997372 CAGTGTGAGATGAAGCTGGAAGG + Intergenic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103598464 12:122038734-122038756 CACAGCCAGGGGAAGGTGCAGGG - Intronic
1103615534 12:122149382-122149404 CAGAGGCAGCTGGAGCAGGATGG - Intergenic
1103719243 12:122964675-122964697 CTCGGCCAGGTGGAGCTGGAGGG + Intronic
1103915682 12:124374449-124374471 CAGAGGCATGTAAGGCTGGAAGG + Exonic
1104603300 12:130168293-130168315 CATAGCAAGGGGAAGCTGCAGGG + Intergenic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1104940685 12:132393246-132393268 CAGAGCCTGGTGTACCTGGGAGG + Intergenic
1106400569 13:29426078-29426100 CAGAGCCAGGTGGGGTGGGAAGG - Intronic
1106755837 13:32821905-32821927 TAGGGACAGGTGAAGCTGGCGGG - Intergenic
1106969106 13:35114575-35114597 CAGAGCCAAGTGAGTCTGGAAGG - Intronic
1107599746 13:42001568-42001590 AAGAGACAGGTGAGGCTGGGAGG - Intergenic
1107768849 13:43767892-43767914 GAGTGCCAGGTGGAGCTGGAGGG - Intronic
1109500677 13:63233595-63233617 CATAGAGAGGTGAAGCTGGCTGG + Intergenic
1111426589 13:88092697-88092719 CTGAGCCACCTGAAGCTGGGGGG + Intergenic
1112756217 13:102637100-102637122 CAGAGCTAAATGAAGCTGAAGGG - Exonic
1113035184 13:106040342-106040364 CTTAGCCACGTGAAGTTGGAGGG + Intergenic
1113356934 13:109589831-109589853 CAGATCTCGGTGAAGATGGATGG + Intergenic
1113516665 13:110908079-110908101 AAGAGCCAGGTGAAGGTGCCCGG + Intronic
1113956527 13:114102476-114102498 CAGAGCCTGGTGCAGCTGCGTGG + Intronic
1115058874 14:29166836-29166858 AACAGCAAGGTGGAGCTGGATGG - Intergenic
1118599978 14:67465191-67465213 CAGAGCGAGGGGAAGCTCCACGG + Intronic
1118791711 14:69099323-69099345 AAGAGCCATGTGAATCTCGATGG - Intronic
1119540719 14:75436401-75436423 AAGAGACAGGTAAAGATGGAAGG + Intronic
1119778914 14:77265428-77265450 CTGTGCCAGATGAAGCTGCAGGG - Intergenic
1121674284 14:95739794-95739816 CAAAGCCAGTTGAAGCTCGGTGG + Intergenic
1121846739 14:97178674-97178696 CAGAGTCAGGTGGAACTGCAAGG + Intergenic
1122099792 14:99398659-99398681 TAGCTCGAGGTGAAGCTGGATGG - Exonic
1123049360 14:105533240-105533262 CATGGCCAGGTGACCCTGGAAGG - Intergenic
1123483860 15:20665834-20665856 CAGAGGCAAGTGAGTCTGGAAGG + Intergenic
1124879554 15:33628586-33628608 CAGGGCCAGGTTAGGGTGGAGGG + Intronic
1126653696 15:50953480-50953502 CAGAGCAGGATGAAGCAGGATGG - Intronic
1126663664 15:51056087-51056109 GAGAGCCAGCTGAGGCTGAATGG + Intergenic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129671847 15:77612036-77612058 CAGACCCAGCTGAACGTGGAGGG - Intergenic
1129702481 15:77775779-77775801 CAGAGACAGGCCAAGCTGGCTGG - Intronic
1130226949 15:82066397-82066419 CAGTGCAAGATGGAGCTGGAGGG - Intergenic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1130644869 15:85715598-85715620 CAGTACCAGGTGGAGCTGGATGG + Intronic
1130644886 15:85715733-85715755 CAGTACCAGGTGGAGCTGGATGG + Intronic
1131167273 15:90151542-90151564 CAGGAACAGGTGTAGCTGGAGGG - Intergenic
1131744445 15:95431390-95431412 CAGAGTCTGGTGAATCTGCAGGG - Intergenic
1132752353 16:1464644-1464666 CAGAGCCAGGTGGGGCCTGATGG + Intronic
1133000630 16:2849778-2849800 TAGAGACAGGTGATGCTGGTGGG + Intergenic
1133015026 16:2935755-2935777 CACAGCCAGGTACAGCTGGGAGG - Intronic
1133056758 16:3149295-3149317 CAGAGCAGGGTGAACCTGCAGGG + Intronic
1133706574 16:8360326-8360348 CAGAGGAAGGTGAACCTGGGAGG - Intergenic
1133795148 16:9040256-9040278 GAGAGCAAGATGAAGCTGGAAGG + Intergenic
1134107075 16:11492850-11492872 CAGAGCCAGGGGGACCTGGGAGG + Intronic
1135919913 16:26640581-26640603 CGGAGGCAGATGAAGCTGGGAGG + Intergenic
1136247457 16:28984167-28984189 CAGAGCCAGGGTGAGCTGGATGG - Intronic
1136548338 16:30967684-30967706 CACAGCCAGGTGGAGGTGCAGGG + Intronic
1137581602 16:49636929-49636951 CACCGCCAGGTGCACCTGGATGG + Exonic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1138432184 16:56975992-56976014 CAGAGCCGGGGAAGGCTGGACGG - Intronic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139474970 16:67198577-67198599 GAGGGCCAGGAGGAGCTGGAGGG - Exonic
1139776437 16:69319704-69319726 CAAAGACAAGTGAAGGTGGAAGG + Intronic
1141175900 16:81719125-81719147 CAGAGCCACCGGAAGCTGCAGGG - Intergenic
1142400167 16:89854436-89854458 CAGCCCCAGGTGAAGCTCCACGG - Intronic
1142469286 17:153942-153964 AGGAGCCAGGGGAAGCTTGAGGG - Intronic
1144328041 17:14200461-14200483 CAGAGCCAGGTGCCACTGGATGG + Intronic
1144458279 17:15436758-15436780 CAGGTCCAGGAGCAGCTGGATGG + Exonic
1144787093 17:17837917-17837939 CAGAGCCAGGTGGGGCAGGAAGG + Intergenic
1145246573 17:21273568-21273590 GAGAACCAGATGAAGCTGCATGG - Intergenic
1145961390 17:28888293-28888315 CAGCGGCAGGTAGAGCTGGATGG + Intronic
1146142445 17:30379365-30379387 CGGCCCCAGGTGAAGCTGGTGGG + Exonic
1147121251 17:38336423-38336445 CAGAGGCTGCTGGAGCTGGAAGG + Intronic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1149655312 17:58306736-58306758 CAGGGTCAGGTGGAGTTGGAAGG + Intronic
1151476928 17:74349385-74349407 CAGAGCAACGTGAGGCTGGCCGG - Intronic
1152538734 17:80964254-80964276 CACGGCCAGGTGAGGCTGCAAGG - Exonic
1152753418 17:82077124-82077146 GAGAGCCGGGAGAAGCAGGAGGG + Intergenic
1152924179 17:83079959-83079981 CAGCGACCGGTGCAGCTGGAAGG + Exonic
1155074845 18:22345634-22345656 CTGAGCCAGCTCAGGCTGGATGG + Intergenic
1155381335 18:25225689-25225711 CACAGCCAAGTGGAGCTGAATGG + Exonic
1155913999 18:31537902-31537924 CTGAGGCAGGTGAACCTGGGAGG + Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156507588 18:37608133-37608155 CAGAGCCAGAGGACGGTGGAGGG + Intergenic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1160202547 18:76807535-76807557 CCGAGCTAGGTGTAGCTGGAAGG + Intronic
1161590839 19:5128448-5128470 CAGTCCCCGGTGAGGCTGGATGG + Intronic
1161951101 19:7468695-7468717 CAGAGCCAGGTGCAGCCTGAAGG - Intronic
1162124727 19:8493371-8493393 GAGAGGCAGGAGCAGCTGGAGGG - Intronic
1162440300 19:10688340-10688362 CAGGGCCAGGTGACCCTGCAGGG + Intronic
1162629735 19:11917722-11917744 CTGAGCCAGGAGAATCTGGGAGG - Intergenic
1163625718 19:18388358-18388380 CAGAGCCCGGTGAAGGCGGGAGG - Exonic
1163682551 19:18691635-18691657 CAGAGCCCCCAGAAGCTGGAAGG + Intronic
1163682675 19:18692224-18692246 CGGAGCCAGCTGGAGCTGGCTGG + Intronic
1163689332 19:18730278-18730300 CAGATCCAGGGGAGGCAGGAGGG - Intronic
1164418684 19:28067712-28067734 CAGAGCAAGGTCAGGCTGCAAGG + Intergenic
1164449522 19:28348428-28348450 CAGAGGCAGGAGAACCTGGGAGG + Intergenic
1164550931 19:29212107-29212129 CAGGGCCAAGTAAAGATGGAAGG + Intronic
1165827602 19:38714161-38714183 CAGAGGAGGGTGAGGCTGGACGG - Intronic
1165881603 19:39047943-39047965 CAGAGACAGGTGAGACAGGAGGG + Intergenic
1165931905 19:39364691-39364713 CAGTGCCAGGTGGAGTTGGGAGG + Intronic
1167472948 19:49685590-49685612 GTGAGCCGGGTGAAGCTGGGTGG + Intronic
1167923724 19:52806281-52806303 GAGAGCCACTTGAATCTGGAAGG - Intronic
1168710811 19:58498970-58498992 CAGAGCTGGGCGAGGCTGGAGGG - Intronic
925155735 2:1647957-1647979 CAGAGCCAGGGGTGGATGGACGG - Intronic
925305382 2:2844751-2844773 CAGAGCCTGCTGTAGGTGGAAGG - Intergenic
926001867 2:9339811-9339833 GAGAGGCAGGTGAGGCTGGAAGG - Intronic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
928291547 2:30042094-30042116 TAGAGCCAGCAGAAGCTGGGAGG + Intergenic
928403310 2:30994814-30994836 AAGAGCGATGTGGAGCTGGAAGG + Intronic
928793879 2:34992242-34992264 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
929003222 2:37368324-37368346 CAGAGTCAGGAGAAGATGCAGGG - Intronic
929075897 2:38078491-38078513 CTGAGCCAGGAGAACCTGGCAGG - Intronic
929300530 2:40299157-40299179 CAGAGCCATGTGAGGCTGTTGGG + Intronic
929807813 2:45162496-45162518 CAGAGGCTGGTGATGCAGGAAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932207515 2:69896092-69896114 CAGAGCCAGGTGGGGCTTGGTGG - Intronic
932595796 2:73092837-73092859 CAGAGGGAGGTGGGGCTGGAAGG - Intronic
934711977 2:96522363-96522385 CACACCCAGCAGAAGCTGGAGGG - Intergenic
934984465 2:98874372-98874394 CAGAGCCATGTCCACCTGGAAGG - Intronic
936042538 2:109160847-109160869 CAGGGCCAGGAGAGGCTGCAAGG + Intronic
936107858 2:109640821-109640843 CAGGCCCAGGTGTAGCAGGAAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936940517 2:117879358-117879380 CACAGCCAGGGGATGCCGGAGGG + Intergenic
936951017 2:117977559-117977581 AAGAGCCAGGTAAATCAGGATGG - Intronic
937022643 2:118672362-118672384 CAGAGACAACTGCAGCTGGAAGG - Intergenic
937217088 2:120319601-120319623 CAGCACAAGGTGAAGCTGGCTGG + Intergenic
937265410 2:120612077-120612099 GAGATCCAGGTGAAGCGGGCTGG - Intergenic
937758801 2:125574650-125574672 CAGGGCCATGAGAGGCTGGAGGG - Intergenic
937771101 2:125721539-125721561 CAGTGCCAGGTGACACAGGATGG - Intergenic
937877325 2:126835563-126835585 CAGGGCCAGGAAATGCTGGAGGG + Intergenic
939566386 2:143790775-143790797 CTGAGCTAGGTGAAGCTGGGGGG + Intergenic
942242916 2:173980173-173980195 CAGAGACAGCCGAAGCTGTAGGG - Intergenic
943151160 2:184115390-184115412 CAGAGCAAGATGAAGCAGGCTGG + Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
943668139 2:190632199-190632221 CAGAGCCCTGTGAGGCTGCAAGG - Intergenic
944317951 2:198303496-198303518 CTGGACCATGTGAAGCTGGAAGG - Intronic
946148714 2:217749725-217749747 CAGACTCTGGTGAAGCTGGCAGG - Intronic
947719648 2:232362757-232362779 CAGAGCCGGATGCAGCTGGGAGG + Intergenic
947772586 2:232682354-232682376 CGGAGCAAGGTGAAGAGGGAGGG - Exonic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948627255 2:239276770-239276792 CAGAGCCAGGCGAGGCAAGACGG + Intronic
948654344 2:239467154-239467176 CAGAGGAAGGTAAAGCCGGAGGG + Intergenic
948897856 2:240935511-240935533 CAGCGGCAGGAGCAGCTGGAGGG + Intronic
1168893868 20:1310715-1310737 CTGAGCCAGGTGCACCTGGGAGG + Intronic
1169422267 20:5470247-5470269 CAAAGCCAGGTGAAGCTTTCCGG + Intergenic
1169424185 20:5483721-5483743 CAGAGCTAGGAGCCGCTGGAGGG + Intergenic
1170467782 20:16638630-16638652 CAGAGCTCAGTGAAGCTGTAGGG + Intergenic
1170812735 20:19687270-19687292 CACATCCAGGTGAAGGTGGAGGG - Intronic
1171194518 20:23186884-23186906 CAGAGCCACGTGCACCTGGGTGG - Intergenic
1171406758 20:24916974-24916996 CAGGCTCAGGAGAAGCTGGAAGG - Intergenic
1171777963 20:29388312-29388334 CAGAGCCAGTAGAATGTGGAGGG - Intergenic
1171819726 20:29823708-29823730 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1172354246 20:34268800-34268822 AAGAGCCAGGTAAGTCTGGATGG + Intronic
1172687711 20:36769260-36769282 CACAACCAGCTGAAGCTAGAGGG - Intronic
1172781426 20:37438940-37438962 CACAGACAGATGAAGCAGGACGG - Intergenic
1172796020 20:37538263-37538285 CAGAGGCTGGTGCAGCTTGAAGG + Intergenic
1172800494 20:37573036-37573058 CAGAGGCAGGGGAAGCTGTCAGG + Intergenic
1173158066 20:40631604-40631626 CAGAGCCAGGTGTGTCTGGATGG - Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1173642689 20:44614974-44614996 CAGAGCCAGGTATAGCTGTGGGG - Intronic
1175985318 20:62761530-62761552 CAGTCCCAGGAGAAGCTGGCCGG + Exonic
1178259768 21:31088374-31088396 CAGAGAGAGGTGAAGCCGGCTGG - Intergenic
1178637078 21:34313412-34313434 GAGAGCCTGGAGAGGCTGGAAGG + Intergenic
1178902072 21:36606079-36606101 CAGAGCCAGGAGGGGCTGGGTGG + Intergenic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179640723 21:42745748-42745770 CAGAGCCAGGCGGAGATGGGTGG + Intronic
1179927960 21:44548637-44548659 CAGAGCCAGGGGACGCTGGCCGG + Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180323728 22:11348399-11348421 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1180702178 22:17787307-17787329 CAGAGCCAGGCAGGGCTGGAAGG + Intergenic
1181002144 22:19992847-19992869 CAGAGCCAGGGTGTGCTGGAGGG - Intronic
1181489988 22:23255682-23255704 CAGAGCCAGGTGTGGGTGGGAGG - Intronic
1182651236 22:31852916-31852938 AAGAGGCAGCTGAAGCTGGATGG + Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183664781 22:39241066-39241088 CAAAGCCAGAGGAAGCTGGATGG + Intronic
1184060305 22:42077483-42077505 CTGAGCCTGGTGGTGCTGGAAGG + Exonic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
949186914 3:1202687-1202709 CAGAACCAGCTGAACCTTGAAGG + Intronic
950282483 3:11719727-11719749 CTGAGCCAGGTGAGCCGGGAGGG + Intronic
950740135 3:15044171-15044193 TAGGGCCTGGTAAAGCTGGATGG + Exonic
951097444 3:18648548-18648570 CAGACCATGTTGAAGCTGGAAGG + Intergenic
952331017 3:32364603-32364625 GAGAGGCAGGTGAAGCTCCAGGG + Intronic
952964975 3:38615452-38615474 TAGGGCCATGTGAAGATGGAGGG - Intronic
952968576 3:38636673-38636695 CAGAGCCAGGTGCAGGTGGTGGG - Intronic
953167959 3:40482144-40482166 CAGTGCCAGGGGTAGCTGGATGG + Intronic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
953681990 3:45046305-45046327 CAGAGCTGGGTGGAGGTGGATGG + Intergenic
953699251 3:45183356-45183378 CAGAGCTGGGTGGAGGTGGATGG + Intergenic
954330128 3:49885412-49885434 CAGAGCGAGCAGCAGCTGGATGG + Intergenic
954426669 3:50447040-50447062 CAGGGAAAGGTGTAGCTGGATGG + Intronic
954598547 3:51849800-51849822 CATTGACAGGTGAAGCTGGCTGG + Intergenic
954695518 3:52422873-52422895 CAGCCACAGGTGAGGCTGGAGGG + Exonic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955225053 3:57053399-57053421 CAGAGGCAGGGCAGGCTGGAGGG - Intronic
955785330 3:62532068-62532090 GCAAGCTAGGTGAAGCTGGAAGG - Intronic
956843348 3:73159718-73159740 CATTGACAGGTGAAGCTGGCTGG - Intergenic
957087209 3:75692247-75692269 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
958627634 3:96646569-96646591 CAGTGCGAAGTGAAGCTGGCTGG - Intergenic
959934043 3:112011703-112011725 CAGAGCCAAGGAATGCTGGAAGG - Intronic
960519483 3:118638581-118638603 CAGAGCCCTGTGGAGCTGGAAGG + Intergenic
961451371 3:127003792-127003814 CAGAGGCAGGTGTCACTGGAGGG + Intronic
962875791 3:139535271-139535293 GAGAGCCAGGAGAACCTGGCAGG - Intronic
963103250 3:141624822-141624844 CAGAGCCGGGTGGGGCTAGAAGG - Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
963700296 3:148617781-148617803 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
964200281 3:154111456-154111478 CTGAGCCAGGTGAAGCTGAAAGG + Intergenic
964371992 3:156009585-156009607 CAGAGCCAGCTGCAGCAAGATGG + Intergenic
965139266 3:164814444-164814466 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
965139876 3:164818668-164818690 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
965531496 3:169774488-169774510 CAGAGTCAGGTGAAGGCTGATGG + Exonic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966236012 3:177702363-177702385 CAGACCCAGGTGTAGTTTGAAGG + Intergenic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
966940891 3:184746378-184746400 CTGAGTCAGGTGCAGCTGCAGGG + Intergenic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
968655388 4:1776360-1776382 TAGAGCCAGGTGTGGCTGGAAGG - Intergenic
968815617 4:2820197-2820219 CAGTGCCAGGTGAACCTATAAGG - Intronic
969108443 4:4826058-4826080 CAAAGACAGGTAAAGATGGATGG - Intergenic
969625483 4:8302883-8302905 TGGAGCCAGCAGAAGCTGGAAGG - Intronic
970171591 4:13295963-13295985 CTGAACGAGGTGGAGCTGGATGG - Intergenic
970233815 4:13938477-13938499 CAGAGCCAGGTTGGGCTTGATGG + Intergenic
971452185 4:26810482-26810504 CAGAGAAGGGTCAAGCTGGATGG - Intergenic
972142817 4:35982533-35982555 GAGAGGCAGGTGTAGGTGGATGG - Intronic
974217230 4:58865555-58865577 CAATGTCAGGTGAAGATGGAAGG - Intergenic
974859263 4:67499423-67499445 AAGAGCAAGGTGAAGCAGCAAGG - Intronic
974954164 4:68617829-68617851 CAGAGACTGGTGAGCCTGGATGG - Intronic
975132869 4:70845954-70845976 AAAAGGCAGGTGTAGCTGGAAGG - Intergenic
976596978 4:86904072-86904094 CAGTGAGAGGTGAAGCTGGCTGG - Intronic
978159377 4:105527324-105527346 CAGCACCAGGAGCAGCTGGAGGG - Intergenic
982143908 4:152360670-152360692 CAGAGCTAGGTGACTATGGAAGG + Intronic
982224313 4:153152274-153152296 CAGAGGCAGGTGCGGCTGGCTGG + Intergenic
982293841 4:153806534-153806556 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
984274549 4:177594113-177594135 CAGAGTCAGGGGCTGCTGGATGG - Intergenic
985390505 4:189487677-189487699 CTGAGCCAGGGGAGGCTGAACGG - Intergenic
985627577 5:997851-997873 CAGAGCCAGGTGAGGGCAGATGG - Intergenic
985708418 5:1414662-1414684 CAGGCCCAGGTGCAGCAGGAGGG + Intronic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986287481 5:6370586-6370608 CAGAGGGAGGCGAAGCTGCAGGG + Intergenic
986491966 5:8302360-8302382 TAGAGCCAAGAGAAGATGGATGG - Intergenic
986695550 5:10352054-10352076 CAGAGCCAGGTTAGGATGAAGGG - Intergenic
986989493 5:13535199-13535221 GACAGCCAGGTGAGGATGGAAGG - Intergenic
988611960 5:32735245-32735267 CAGAGCCAGATGGAGGAGGAGGG - Intronic
989172088 5:38481985-38482007 CAGCCGCAGATGAAGCTGGAGGG - Exonic
990483242 5:56231834-56231856 CAAAGCCAGATGTAGCTTGAGGG + Intronic
993068954 5:83134249-83134271 CAGTGAGAGGTGAAGCTGGCTGG + Intronic
994258154 5:97625228-97625250 TAGAGCCAGGTGGAACTGTAAGG + Intergenic
995707408 5:114999528-114999550 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
997520746 5:134523590-134523612 CACAGCCAGGTCTAACTGGAAGG + Intergenic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
998701607 5:144708948-144708970 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
998859460 5:146428436-146428458 CAGAGCCAGGTGGTGCTGTGTGG + Intergenic
999079277 5:148827564-148827586 CTTAGCCAGGTGGAGCAGGATGG + Exonic
999317639 5:150594500-150594522 CAGATCCAGGGGCAGGTGGAGGG - Intergenic
999979236 5:156941932-156941954 CAAAGCCAGTTGAAGCTTCAAGG - Intronic
1002533563 5:179863812-179863834 GAGAGCCAGGTGGTGGTGGAGGG - Exonic
1002705706 5:181159994-181160016 CAGAGCCAGGGGGTGCTGCAGGG + Intergenic
1003245139 6:4376691-4376713 CAGGGCCAGGTGGAACAGGAAGG - Intergenic
1006257774 6:32844832-32844854 CAGAGCCAGGCGAGCCAGGAAGG + Intronic
1006302336 6:33200267-33200289 CGGAGCCAGGGGAGGCTGGACGG - Exonic
1006378979 6:33687016-33687038 CAGAGCCAGGAGCAGCTTGGAGG - Exonic
1006848079 6:37077230-37077252 CAGAGGCAGGAGAATCTGGTGGG + Intergenic
1006911624 6:37566906-37566928 CAGACACAGGGGCAGCTGGAAGG - Intergenic
1007088284 6:39166156-39166178 CAGAGAGGGGTGAGGCTGGAAGG - Intergenic
1007727928 6:43927889-43927911 CAGAGCCCGGTGAAGCAGAGGGG + Intergenic
1008551755 6:52639342-52639364 CAGTGAGAGGTGAAGCTGGCTGG - Intergenic
1014623199 6:123694904-123694926 GAGGGGCAGGTGAAGCTAGAAGG + Intergenic
1014797947 6:125747955-125747977 CGGGGCCAGGTGGGGCTGGATGG - Intronic
1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG + Intergenic
1016853783 6:148645841-148645863 AAGAGCCAGGTGATGGTAGAGGG - Intergenic
1016988159 6:149910285-149910307 CCGAGCCAGGTCATCCTGGAAGG - Intergenic
1017907969 6:158769779-158769801 AAGAGCCAGGAGCAGCTGGTAGG - Exonic
1018837859 6:167498611-167498633 CAGAGACAGGTGCAGAGGGAAGG + Intergenic
1018899890 6:168045748-168045770 CAAAGCCAGGTGAAACCAGAGGG + Intergenic
1018978048 6:168580449-168580471 CAGAGCCAGGAAAGGCTGCATGG - Intronic
1019313388 7:373641-373663 CAAAGCCTGATGAAGCTGCATGG - Intergenic
1020074858 7:5251172-5251194 TGGAGCCACGAGAAGCTGGAAGG - Intergenic
1020111549 7:5450840-5450862 CAGAGCCTGCAGAATCTGGAAGG - Intronic
1021639423 7:22723281-22723303 AAGAGCCAGCTGATGTTGGAGGG - Intergenic
1022468235 7:30665532-30665554 CAGGGCCAGGAAAAGCAGGAAGG + Exonic
1023072640 7:36452028-36452050 TAGAGCCAGGTGAAGGTCCATGG + Intronic
1024243512 7:47453134-47453156 CACAGCCAGGAGCAGCTGGCAGG + Intronic
1026105535 7:67417917-67417939 CAGAGCAGGGTGGAGCTGCATGG - Intergenic
1026774285 7:73221440-73221462 GAGAACCAGTTGAACCTGGAAGG - Intergenic
1027015142 7:74774826-74774848 GAGAACCAGTTGAACCTGGAAGG - Intronic
1027072889 7:75171127-75171149 GAGAACCAGTTGAACCTGGAAGG + Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028638907 7:93021601-93021623 GAGAGGCAGGTAAAGCTGGGTGG + Intergenic
1029365184 7:100112077-100112099 CAGGGCCAGGGCAAGCTGGTGGG + Intronic
1029595195 7:101533940-101533962 CAAAGCCAGGTGGGGCTGAAGGG + Intronic
1030922462 7:115408648-115408670 CAGAGCAGGGTGGATCTGGAAGG + Intergenic
1031846006 7:126806672-126806694 CAGTGACAGGTGAAGCCGGCTGG - Intronic
1033718933 7:144036206-144036228 GAGAGCAAGGTAAAGATGGAGGG - Intergenic
1033733233 7:144198059-144198081 GAGAACCAACTGAAGCTGGAGGG - Intergenic
1033749817 7:144352928-144352950 GAGAACCAACTGAAGCTGGAGGG + Intergenic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1034282040 7:149861337-149861359 CACAGCCAGGTGCAGCCGGTGGG - Exonic
1034398410 7:150845629-150845651 CAGACACAGCTGCAGCTGGAGGG + Intronic
1035356548 7:158279393-158279415 CAGTGAGAGGTGAAGCTGGCTGG - Intronic
1036025233 8:4900233-4900255 CACTGGCAGGTGAAGCTCGAAGG - Intronic
1036592096 8:10178007-10178029 AAGAGGCAGGTGAAGCGGTAAGG - Intronic
1036653775 8:10662583-10662605 CCGAGTCAGGGGAAGCGGGAGGG - Intronic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1037733059 8:21545319-21545341 CAGAACAAGATGCAGCTGGAGGG + Intergenic
1038004315 8:23417016-23417038 CACAGCCAGCTGTGGCTGGAAGG - Intronic
1038429807 8:27491113-27491135 CAGAGCCGGGCCAAGCTGGGCGG + Exonic
1038704203 8:29878802-29878824 CAGAGCCGGCTGCAACTGGAAGG + Intergenic
1040076880 8:43246307-43246329 CAGAGCCTGGAACAGCTGGAAGG - Intergenic
1040444360 8:47478422-47478444 CAGAGACAGAAGAAGCAGGAAGG + Intronic
1041554104 8:59133763-59133785 CAGAGAGATGTGGAGCTGGAAGG - Intergenic
1042181083 8:66088234-66088256 CAGCTCCAGATGAGGCTGGAAGG - Intronic
1044804399 8:95990440-95990462 CAGGTACAGGTGAAGCTGGGAGG - Intergenic
1045315472 8:101040257-101040279 CAGAGCCACCAGAAGCTGGAAGG - Intergenic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1048544561 8:135374440-135374462 AAGAGGCAGGTGGAGCTGCATGG - Intergenic
1048738293 8:137526272-137526294 CAGAGCCAGCTGAAGCCAAATGG - Intergenic
1049160798 8:141096296-141096318 CAAATCCAAGTGAAGCTGGGTGG - Intergenic
1049301441 8:141872706-141872728 CAGAGGCAGGTGAGGGTGGTGGG + Intergenic
1051366577 9:16325566-16325588 CAGAGCCACGTGCAGATGGCGGG - Intergenic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1052566723 9:30162526-30162548 CAGAGCCAGCAGTAGCTGAAGGG + Intergenic
1053270030 9:36743426-36743448 CAGTGCCAGGTAAGGCTGAAGGG + Intergenic
1053415534 9:37944840-37944862 GAGAGTCAGGAGAAGCTGCAGGG - Intronic
1053442403 9:38127208-38127230 CACAGCCTGGTGAAGATGGACGG - Intergenic
1053750661 9:41251267-41251289 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054256172 9:62815610-62815632 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054335132 9:63800004-63800026 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1055638137 9:78297480-78297502 CAGGGCCAGGGGCAGCTGCACGG - Intronic
1056098085 9:83274578-83274600 CACAGACAGGTGGTGCTGGAAGG + Intronic
1056262030 9:84858443-84858465 CAGAGGCTGATGCAGCTGGAAGG - Intronic
1056689992 9:88799880-88799902 CAGAGCCACGTGATTCTAGAAGG - Intergenic
1058447087 9:105064085-105064107 CAGAGGCAGCTGAGGCTGAAAGG - Intergenic
1059466717 9:114473395-114473417 CAGAGCCAGGGGACACTGAAGGG + Intronic
1060205993 9:121683174-121683196 CAGGGCCTGGGGAAGCTGGGTGG - Intronic
1061221703 9:129255803-129255825 AAGAACCAGGTCAGGCTGGAAGG - Intergenic
1062447169 9:136599852-136599874 GAGAGCCAGGTGGCCCTGGAAGG + Intergenic
1203371400 Un_KI270442v1:308973-308995 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1186338427 X:8617427-8617449 CAGAGCCACGTGAAGGGGCAAGG + Intronic
1186382449 X:9075011-9075033 CAGAGGCAGGAGAAGCAGGTAGG + Intronic
1186423498 X:9444922-9444944 CAAAGGCAGGAGGAGCTGGATGG + Intergenic
1187506696 X:19884048-19884070 AAGAACCAGGTGTGGCTGGAGGG + Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1191926563 X:66317572-66317594 AAGAGACATATGAAGCTGGAAGG - Intergenic
1192773489 X:74217521-74217543 ATGATGCAGGTGAAGCTGGAAGG - Intergenic
1196116469 X:112004792-112004814 AAGAACCAGGTGTGGCTGGAGGG + Intronic
1197078934 X:122388912-122388934 CAGTGAGAGGTGAAGCTGGCTGG - Intergenic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1199680459 X:150220905-150220927 CAGAGCCACCAGAAGCTGGAGGG - Intergenic
1201066944 Y:10106110-10106132 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1201489475 Y:14524896-14524918 AAGAGCCAGGTCAGGCTGGGAGG - Intronic