ID: 1047262394

View in Genome Browser
Species Human (GRCh38)
Location 8:123274474-123274496
Sequence CGCGCGGAGGACGCGCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047262394_1047262398 -7 Left 1047262394 8:123274474-123274496 CCCGCGCGCGCGTCCTCCGCGCG 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1047262398 8:123274490-123274512 CCGCGCGCCCCCACCCCGTGCGG 0: 1
1: 0
2: 2
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047262394 Original CRISPR CGCGCGGAGGACGCGCGCGC GGG (reversed) Exonic