ID: 1047262790

View in Genome Browser
Species Human (GRCh38)
Location 8:123276673-123276695
Sequence CCACAGTGCCTGGCATATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047262790_1047262794 18 Left 1047262790 8:123276673-123276695 CCAGTATATGCCAGGCACTGTGG No data
Right 1047262794 8:123276714-123276736 AGTCAACTTTCCTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047262790 Original CRISPR CCACAGTGCCTGGCATATAC TGG (reversed) Intergenic
No off target data available for this crispr