ID: 1047266474 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:123314308-123314330 |
Sequence | CTGTGGATGAATAGGCAAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1047266468_1047266474 | 9 | Left | 1047266468 | 8:123314276-123314298 | CCAAAATGTGAAGCAATCCAAAT | No data | ||
Right | 1047266474 | 8:123314308-123314330 | CTGTGGATGAATAGGCAAAAGGG | No data | ||||
1047266470_1047266474 | -8 | Left | 1047266470 | 8:123314293-123314315 | CCAAATGTCCATCAACTGTGGAT | No data | ||
Right | 1047266474 | 8:123314308-123314330 | CTGTGGATGAATAGGCAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1047266474 | Original CRISPR | CTGTGGATGAATAGGCAAAA GGG | Intergenic | ||
No off target data available for this crispr |