ID: 1047266474

View in Genome Browser
Species Human (GRCh38)
Location 8:123314308-123314330
Sequence CTGTGGATGAATAGGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047266468_1047266474 9 Left 1047266468 8:123314276-123314298 CCAAAATGTGAAGCAATCCAAAT No data
Right 1047266474 8:123314308-123314330 CTGTGGATGAATAGGCAAAAGGG No data
1047266470_1047266474 -8 Left 1047266470 8:123314293-123314315 CCAAATGTCCATCAACTGTGGAT No data
Right 1047266474 8:123314308-123314330 CTGTGGATGAATAGGCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047266474 Original CRISPR CTGTGGATGAATAGGCAAAA GGG Intergenic
No off target data available for this crispr