ID: 1047268858

View in Genome Browser
Species Human (GRCh38)
Location 8:123335339-123335361
Sequence TACAGGGAAATGCCTAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047268855_1047268858 -9 Left 1047268855 8:123335325-123335347 CCAGAACTCTGAACTACAGGGAA 0: 1
1: 0
2: 2
3: 18
4: 142
Right 1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG No data
1047268852_1047268858 5 Left 1047268852 8:123335311-123335333 CCTACTGCTTGACTCCAGAACTC 0: 1
1: 0
2: 2
3: 31
4: 207
Right 1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047268858 Original CRISPR TACAGGGAAATGCCTAGGGA AGG Intronic
No off target data available for this crispr